ID: 979776931

View in Genome Browser
Species Human (GRCh38)
Location 4:124601143-124601165
Sequence GAAACCAACAAAATAACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979776930_979776931 -3 Left 979776930 4:124601123-124601145 CCAGCTGTGTTTAGCAGAGTGAA No data
Right 979776931 4:124601143-124601165 GAAACCAACAAAATAACCTCTGG No data
979776929_979776931 23 Left 979776929 4:124601097-124601119 CCTAATAATTAAAAAAAATGGGT No data
Right 979776931 4:124601143-124601165 GAAACCAACAAAATAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979776931 Original CRISPR GAAACCAACAAAATAACCTC TGG Intergenic
No off target data available for this crispr