ID: 979780407

View in Genome Browser
Species Human (GRCh38)
Location 4:124644695-124644717
Sequence CAGCCCTTTTAGAAGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979780405_979780407 6 Left 979780405 4:124644666-124644688 CCGGGGCAAAATTTGAGCTAGTC No data
Right 979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979780407 Original CRISPR CAGCCCTTTTAGAAGATTGA GGG Intergenic
No off target data available for this crispr