ID: 979782769

View in Genome Browser
Species Human (GRCh38)
Location 4:124675262-124675284
Sequence TTCACCAGTACTGCGTAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979782769 Original CRISPR TTCACCAGTACTGCGTAATG CGG (reversed) Intronic
901443956 1:9295620-9295642 TTCACCAGAGCTGGGGAATGGGG + Intronic
906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG + Intronic
920725045 1:208427181-208427203 ATCCCCAGTACTGCGGAATGTGG + Intergenic
924082568 1:240414375-240414397 TTCACCAGTATTGTGGAGTGCGG + Intronic
1064189879 10:13196453-13196475 ATCACAAGTACTGAGTAATATGG - Intronic
1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG + Intergenic
1084301365 11:68254712-68254734 TTCACCAGTGCTGCGTGCTCCGG - Intergenic
1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG + Intronic
1095758578 12:45800401-45800423 TTCTCCAGTACTGAGAAATCTGG - Intronic
1099201805 12:79687051-79687073 TTCACCTGAACTGGGTAATTTGG - Intronic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1102747692 12:115264031-115264053 TACATCAGTACTGCTTAATATGG + Intergenic
1107979896 13:45724671-45724693 TGTACCAGTACTGGGTGATGAGG + Intergenic
1117529668 14:56647629-56647651 TCCAGCAGTACTGTTTAATGGGG + Exonic
1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG + Intergenic
1135530722 16:23251070-23251092 TTCACCAGAACTGTGTCATATGG - Intergenic
1147451673 17:40509639-40509661 TCCAAAAGTACTGCGGAATGTGG - Intergenic
1147642342 17:42011074-42011096 TTCTCCAGCACTGAGTGATGTGG - Intronic
1148211311 17:45810526-45810548 GCCACCAGCACTGCGTTATGCGG + Intronic
1160799322 19:960479-960501 GTCCCCACTACTGGGTAATGGGG + Intronic
1166946869 19:46402777-46402799 TGCACCAGCACTGCGTGATGTGG - Intergenic
1167985051 19:53307537-53307559 TTCAGCAGTTCTGCTTCATGTGG - Intergenic
925701944 2:6647626-6647648 ATCGACAGTACTGCCTAATGAGG - Intergenic
928253662 2:29703506-29703528 TTCAGCAGTTCTGGGAAATGAGG - Intronic
930002956 2:46873598-46873620 TTCACCAGATCTGTGCAATGGGG - Intergenic
945986089 2:216354743-216354765 TTCACCAGTCTTGCTCAATGAGG - Intronic
946964872 2:225027070-225027092 TTCCCTAGTACTGTGTACTGAGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947274719 2:228377477-228377499 TTCTCCAGCACTGAGAAATGGGG - Intergenic
1169961598 20:11166259-11166281 TTCACCAGTGCTTCTCAATGTGG + Intergenic
1184313013 22:43660608-43660630 TTGACCAGGACTGTGTTATGTGG - Intronic
963428863 3:145169943-145169965 TTTAGCTGTACTGCATAATGTGG - Intergenic
965115494 3:164482868-164482890 TTCAGCAGTCCTGCGTGCTGTGG + Intergenic
965336924 3:167437825-167437847 TTCAGTTGTACTGCGTGATGTGG + Intergenic
971290981 4:25339231-25339253 ATCACCAGTACTTCAGAATGTGG - Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
986376405 5:7136469-7136491 GTCACCAGTGCTTTGTAATGGGG - Intergenic
990773641 5:59280227-59280249 TTAACCAGTATTGCCTAATGAGG - Intronic
996845283 5:127891972-127891994 GGCAGCAGTACTGGGTAATGTGG - Intergenic
1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG + Intergenic
1006698842 6:35955283-35955305 CTCACCAGGACTGCCTGATGTGG - Exonic
1008771224 6:54981082-54981104 TTCATAAGTACTGAATAATGAGG + Intergenic
1013260003 6:108432456-108432478 ATCACCATTACTCCGCAATGGGG - Intronic
1017000523 6:149993968-149993990 TTCAACAGAAATGAGTAATGGGG - Intergenic
1017621795 6:156306851-156306873 TTTACCAGTTCTGTGAAATGAGG - Intergenic
1018540148 6:164870841-164870863 TTCACCTGTTATGCTTAATGAGG + Intergenic
1025789739 7:64678260-64678282 TTTAGCAGTACTGAATAATGAGG + Intronic
1026449268 7:70513060-70513082 TTTAACAGATCTGCGTAATGGGG + Intronic
1026608774 7:71838702-71838724 ATCACCAGAACTGCAGAATGGGG - Intronic
1030640154 7:111995789-111995811 TTTAGCAGCACTGCGAAATGAGG - Intronic
1036600049 8:10252420-10252442 TTCACCAGTATTGAGTCCTGGGG + Intronic
1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG + Intergenic
1045040417 8:98218824-98218846 TACAACAGCACTGCGTTATGTGG + Intronic
1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG + Intergenic
1058323833 9:103670192-103670214 TTCCCCAGCACTGCGTAACTAGG - Intergenic
1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG + Intergenic
1061315759 9:129794899-129794921 TTCACCTGTAGTGCTTAGTGCGG - Intergenic
1185914485 X:4021074-4021096 TTCTCCAGGACTCCGTCATGAGG - Intergenic
1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG + Intronic
1188441791 X:30220820-30220842 TCCACCAGTACTACGAGATGGGG + Intergenic
1196157862 X:112450670-112450692 TTCACCAGTGCTACATAATTAGG + Intergenic
1197101564 X:122662126-122662148 TTAATGAGTACTACGTAATGGGG + Intergenic