ID: 979783202

View in Genome Browser
Species Human (GRCh38)
Location 4:124682036-124682058
Sequence GTGCATACACAGCATTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979783202_979783207 8 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783207 4:124682067-124682089 AATGCACAGGGAGGCCGAGGCGG 0: 1
1: 0
2: 4
3: 177
4: 2064
979783202_979783204 -4 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783204 4:124682055-124682077 GCACTTAAAAAGAATGCACAGGG 0: 1
1: 1
2: 0
3: 31
4: 287
979783202_979783205 -1 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783205 4:124682058-124682080 CTTAAAAAGAATGCACAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 265
979783202_979783203 -5 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783203 4:124682054-124682076 TGCACTTAAAAAGAATGCACAGG 0: 1
1: 0
2: 0
3: 29
4: 330
979783202_979783208 9 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783208 4:124682068-124682090 ATGCACAGGGAGGCCGAGGCGGG No data
979783202_979783212 26 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783212 4:124682085-124682107 GGCGGGTGGATCACGAGGTCAGG 0: 10093
1: 44413
2: 59814
3: 53998
4: 32506
979783202_979783206 5 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783206 4:124682064-124682086 AAGAATGCACAGGGAGGCCGAGG 0: 1
1: 0
2: 4
3: 25
4: 255
979783202_979783209 12 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783209 4:124682071-124682093 CACAGGGAGGCCGAGGCGGGTGG No data
979783202_979783210 21 Left 979783202 4:124682036-124682058 CCTAGCAAATGCTGTGTATGCAC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 979783210 4:124682080-124682102 GCCGAGGCGGGTGGATCACGAGG 0: 5927
1: 32816
2: 53619
3: 61670
4: 48833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979783202 Original CRISPR GTGCATACACAGCATTTGCT AGG (reversed) Intronic
903640553 1:24857011-24857033 GTGGAAAACCAGCATTTGCTGGG - Intergenic
906937699 1:50228650-50228672 GGGCATTCACAGGATTTGCAAGG + Intergenic
907389704 1:54150253-54150275 GTCCATACATTGCATTTGGTCGG + Intronic
907664970 1:56426676-56426698 GGGCATACAGAACAGTTGCTAGG + Intergenic
908999717 1:70203963-70203985 GTGAATAAACAGCATTTCATAGG - Intronic
911491254 1:98569298-98569320 GTACATTGAAAGCATTTGCTTGG + Intergenic
916039307 1:160948785-160948807 GTGCATACAAAACATTAGCTGGG - Intronic
916547597 1:165821044-165821066 GTGCATACACAGTGTTTTCCTGG + Intronic
918431162 1:184462224-184462246 GGGCATACAAAGCATATGTTCGG + Intronic
1069857382 10:71448816-71448838 GTCCATACCCACCATCTGCTTGG - Intronic
1071734961 10:88288163-88288185 GTGCATATACAGCATTTGATAGG - Intronic
1076134755 10:128037738-128037760 CTACATACTCAGCATTTGGTAGG + Intronic
1079263527 11:18907611-18907633 ATGAAGACTCAGCATTTGCTTGG + Intergenic
1080868516 11:36215825-36215847 GTGCACACTCAGCATTTCCCCGG + Intronic
1081804411 11:45882649-45882671 GTGCATTCAGAGCATTGGGTTGG + Exonic
1091400010 12:175838-175860 GTGCGTACACGGCATTGGCCGGG - Exonic
1095319716 12:40812309-40812331 GTGTACACACAGCATTCTCTAGG - Intronic
1097550867 12:61066612-61066634 GGGCATTCCCAGTATTTGCTTGG + Intergenic
1098077978 12:66753982-66754004 ATGCTTAAACAGCATTTCCTTGG + Intronic
1105724698 13:23150595-23150617 GTGCATAACAAGCTTTTGCTGGG + Intergenic
1106782819 13:33076786-33076808 GTGCATACACAGCGGTTGGCCGG + Intergenic
1106995668 13:35477402-35477424 GTGCAAAGACTGCATCTGCTGGG - Intronic
1107651220 13:42547180-42547202 GACCTTACACAGCATTGGCTAGG + Intergenic
1109271652 13:60262244-60262266 GTAAAAACAGAGCATTTGCTAGG - Intergenic
1109454861 13:62572108-62572130 CTGCATACACAGCTTTTACAAGG - Intergenic
1118446310 14:65854262-65854284 GTGCATTCACAGCATGTGAGAGG + Intergenic
1123778483 15:23603222-23603244 GAGCCTCCACAGCATTTGCCAGG + Intronic
1124186914 15:27538839-27538861 GTACATACACATCATTCACTGGG - Exonic
1125620125 15:41053067-41053089 GTCCATACATAGCATTTGGATGG - Intronic
1126309742 15:47302027-47302049 GTGCATATTCAGCATTTACTTGG - Intronic
1126555398 15:49982327-49982349 GTCTATACACAGCAGTAGCTAGG - Intronic
1131308197 15:91264436-91264458 GAGCAGAGAAAGCATTTGCTGGG + Intronic
1135945142 16:26858679-26858701 ATGCAAATAAAGCATTTGCTTGG - Intergenic
1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG + Intergenic
1140686268 16:77436277-77436299 AAGCAAACACAGCAGTTGCTGGG + Intergenic
1141474593 16:84264263-84264285 TTGCATACACAGCCTTTTCATGG - Intergenic
1141615702 16:85208258-85208280 GTGCATCCCCAGCATGTGGTGGG - Intergenic
1141860310 16:86711812-86711834 CTGAACACACAGTATTTGCTTGG + Intergenic
1142269129 16:89080007-89080029 GGGCAGACACAGCATTGTCTGGG - Intergenic
1147050276 17:37789368-37789390 GGGCTGACACAGAATTTGCTAGG - Intergenic
1149897989 17:60445402-60445424 GTGCACATACAGCATTTCCTAGG - Exonic
1155762721 18:29587701-29587723 GTGCACACAGAAAATTTGCTAGG + Intergenic
1156972297 18:43170954-43170976 GGGAATTCACACCATTTGCTGGG + Intergenic
1158058167 18:53306493-53306515 GGGCAAACACAGCACTTGCTAGG + Intronic
1161520918 19:4723246-4723268 GTGCATATACAGCATTTGCATGG + Intronic
1164009434 19:21186630-21186652 GTATATACAGAGAATTTGCTTGG - Exonic
1164589304 19:29497565-29497587 TTGCATTCACCCCATTTGCTTGG - Intergenic
1166620598 19:44296711-44296733 GTACATACAGAACATTTTCTAGG + Intronic
924985783 2:268318-268340 GTTCATTCAAAGCATTTGTTTGG + Intronic
925113047 2:1352567-1352589 CTGCAGAGACAGCATTTCCTGGG - Intronic
929555193 2:42921523-42921545 GTGCATTCCCAGCTTTTTCTTGG - Intergenic
929816443 2:45236672-45236694 GTGCATATCCAGAGTTTGCTAGG - Intergenic
930844238 2:55884551-55884573 GTGCAAACACAGCCTTTTGTAGG + Intronic
933505865 2:83176673-83176695 GTGCATAGCAAGCAGTTGCTGGG - Intergenic
934557100 2:95293289-95293311 GGGCACACCCAGCATATGCTAGG - Intergenic
939916651 2:148052831-148052853 GTAAATACACAGCATTTTCCAGG - Intronic
943977291 2:194500144-194500166 ATGCATTAACAGCATTTGCATGG - Intergenic
945137008 2:206640164-206640186 ATACATACACAGAATTAGCTTGG - Intergenic
945142993 2:206707012-206707034 AAGCATACACACCTTTTGCTAGG - Intronic
945166840 2:206955505-206955527 GTGGTGACACAGCATTTCCTAGG + Exonic
945698377 2:213138586-213138608 ATGCATACAATGCATATGCTAGG + Intronic
946673888 2:222136466-222136488 GTGCATGCGAAACATTTGCTGGG + Intergenic
947654778 2:231817565-231817587 CTGCATACACATTATATGCTAGG + Intergenic
1170372487 20:15664757-15664779 GTGCAGACCCAGCCTCTGCTTGG + Intronic
1173008900 20:39163415-39163437 GTGCATGCCCAAGATTTGCTGGG - Intergenic
1173948295 20:46968988-46969010 GTGCATAATGAGCACTTGCTCGG + Intronic
1174538997 20:51274753-51274775 GTGAGAACACAGCATTTTCTTGG - Intergenic
1177676979 21:24313067-24313089 ATGCAGACACAGCGTTTGTTAGG - Intergenic
1185408367 22:50670569-50670591 TTGAATACACAGTATTTGCAGGG - Intergenic
949529660 3:4942094-4942116 GTGCATGCACTGTATTTGTTAGG - Intergenic
949772254 3:7592122-7592144 CTGCATACACAACAGTGGCTAGG - Intronic
952271501 3:31836778-31836800 CTCCATCCACACCATTTGCTTGG + Intronic
952802298 3:37306788-37306810 GTGCATGTACATCATTTACTTGG + Intronic
955296868 3:57743658-57743680 ATAGATACACAGCATTTTCTGGG - Intergenic
955519086 3:59757281-59757303 GTGCAGAAATAGAATTTGCTTGG - Intronic
955878662 3:63521090-63521112 GAGCAGACACAGCAGTAGCTGGG - Intronic
957971583 3:87389570-87389592 ATGTATCCACAGCATTTCCTGGG - Intergenic
963875243 3:150467969-150467991 GTCCATACACTGCAATTGGTTGG + Intergenic
964630459 3:158804108-158804130 GTTCATACACAGCAAATACTGGG - Intronic
965762255 3:172092199-172092221 GTCCATACAGAGCTTTTGCATGG - Intronic
967791408 3:193552885-193552907 TAGTATACACAGCATTTTCTTGG - Intronic
969138898 4:5052038-5052060 GGGCACACACTGCATTCGCTGGG - Intronic
969497444 4:7534247-7534269 GTGCAGACACTGGATTTGCAGGG + Intronic
972799021 4:42453264-42453286 TTGTATACACAGCAGTTGCTGGG - Intronic
972863484 4:43201614-43201636 GTGCTTACATGGCCTTTGCTTGG - Intergenic
979783202 4:124682036-124682058 GTGCATACACAGCATTTGCTAGG - Intronic
980238420 4:130138994-130139016 GTGCATATCCTGCAATTGCTAGG - Intergenic
981088322 4:140706418-140706440 GTGCATACTAAGCACTTTCTAGG - Intronic
981766412 4:148255141-148255163 GTGCACACACAGCATTGACAGGG + Intronic
985185981 4:187316176-187316198 GTGCTTACAGAGCAGTTGCAGGG - Intergenic
987437048 5:17907174-17907196 GTGCATGCACAGCATTCTCTTGG + Intergenic
988860349 5:35271004-35271026 TCGAATACCCAGCATTTGCTTGG - Intergenic
997237749 5:132283639-132283661 GTGCACATACGGCATTTCCTCGG + Intronic
1001585527 5:172831602-172831624 GTGCATCCCCAGCATGTGCAGGG + Intergenic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1003201513 6:3965533-3965555 ATGCTTACCCAGCATTTCCTTGG - Intergenic
1008190997 6:48456984-48457006 GTGCATACATAGTATCTTCTTGG - Intergenic
1010931480 6:81809097-81809119 GTGTAAACACAGCATATCCTAGG + Intergenic
1011431445 6:87291400-87291422 GTGCATACACACCACTTGCAAGG + Intronic
1017838402 6:158201124-158201146 GGGCAGACTCAGCATTTCCTTGG - Intergenic
1019862404 7:3671964-3671986 ATGCCTACACAGTAGTTGCTTGG + Intronic
1020518039 7:9149969-9149991 GTGCAGATACACAATTTGCTAGG + Intergenic
1020625205 7:10569434-10569456 GAGCGTGCAGAGCATTTGCTTGG - Intergenic
1020733869 7:11920707-11920729 GTGCATACAAAACATTTTCCAGG + Intergenic
1021614461 7:22488057-22488079 GTGCAGCCACAGCAGTTTCTGGG - Intronic
1021687789 7:23204293-23204315 GTGCATACAAATCATTTGGTGGG - Intergenic
1021795314 7:24248758-24248780 CTGAAGACACAGCATCTGCTAGG - Intergenic
1024513494 7:50221659-50221681 GTGCATAAACACAAGTTGCTGGG + Intergenic
1024974437 7:55100371-55100393 GTTTACACACAGCATCTGCTGGG - Intronic
1029997678 7:105024226-105024248 GTGGATACTTAGCATTTGGTAGG + Intronic
1030842428 7:114372426-114372448 GAGTAAACACAGCATTTCCTGGG + Intronic
1036103896 8:5818965-5818987 GTGCATACAAAACATTAGCATGG - Intergenic
1036756155 8:11472548-11472570 TTGCATGCACAGCATTTGAAGGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039392218 8:37190505-37190527 GTGCCTACCCAGCATTTCTTTGG - Intergenic
1039764144 8:40610269-40610291 GTGCATACAAAAAATTTGTTTGG - Intronic
1041989623 8:63970804-63970826 CTGAATACAGAACATTTGCTTGG + Intergenic
1044914051 8:97093300-97093322 GTATACACACAGCATTTGCTGGG - Intronic
1045911872 8:107419409-107419431 CTGCATAAACAGGTTTTGCTAGG + Intronic
1049007103 8:139862707-139862729 GTGCATACTCAGCAAGTCCTGGG + Intronic
1050860747 9:10427275-10427297 GTGCTTACACTGTATTTGTTTGG - Intronic
1051333189 9:16044015-16044037 GTGCAGAAACAGCATTTGATTGG + Intronic
1054993362 9:71355749-71355771 GTGGATACAGAGCATGAGCTAGG + Intronic
1055497571 9:76870944-76870966 GTGCCTACAAAGCAACTGCTGGG + Intronic
1187839106 X:23467356-23467378 GTGCATACAGAGCATTCTCCAGG - Intergenic
1188746438 X:33850578-33850600 GTCCAGACACTGAATTTGCTAGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192017040 X:67342284-67342306 TTGCAAACACAGCTTTTGGTAGG - Intergenic
1192037368 X:67578779-67578801 GTGCATAGACAGAATGGGCTGGG + Intronic
1192188122 X:68969780-68969802 GTGCATACAGAACATTTTCCAGG + Intergenic
1194220638 X:91184882-91184904 GTGCATACAGAACACTTGCAGGG + Intergenic
1196177706 X:112658464-112658486 GTGCATTGAAATCATTTGCTTGG - Intronic
1198618812 X:138484737-138484759 GTTCATACACATCATCTGCAAGG + Intergenic
1199924290 X:152446400-152446422 TTGCATACATAACATTTACTAGG - Intronic
1200020039 X:153195602-153195624 GTGCATTCACTGCATTTGTCAGG - Intergenic
1200557147 Y:4648634-4648656 GTGCATACAGAACACTTGCAGGG + Intergenic