ID: 979785338

View in Genome Browser
Species Human (GRCh38)
Location 4:124710787-124710809
Sequence CATAACTCCATGGTTATAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979785334_979785338 24 Left 979785334 4:124710740-124710762 CCTGATTCCACAGCTCAGCAACA 0: 1
1: 0
2: 1
3: 32
4: 203
Right 979785338 4:124710787-124710809 CATAACTCCATGGTTATAACTGG 0: 1
1: 0
2: 0
3: 4
4: 68
979785336_979785338 -4 Left 979785336 4:124710768-124710790 CCTAAATTTTAATGAGTCACATA 0: 1
1: 0
2: 2
3: 22
4: 285
Right 979785338 4:124710787-124710809 CATAACTCCATGGTTATAACTGG 0: 1
1: 0
2: 0
3: 4
4: 68
979785335_979785338 17 Left 979785335 4:124710747-124710769 CCACAGCTCAGCAACACTTTTCC 0: 1
1: 0
2: 0
3: 22
4: 192
Right 979785338 4:124710787-124710809 CATAACTCCATGGTTATAACTGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979785338 Original CRISPR CATAACTCCATGGTTATAAC TGG Exonic
916697366 1:167252785-167252807 GATAACTTCTTGTTTATAACAGG + Intronic
920778149 1:208961139-208961161 CATTACTCCAAGGTGATAATTGG - Intergenic
923785217 1:237060272-237060294 CTTAACTCCATGGGTATAATGGG + Intronic
1064056468 10:12101900-12101922 CAGAAATACATGGTTATATCTGG - Intronic
1065127812 10:22591095-22591117 CATAATTCCATTGTAATCACTGG - Intronic
1080443445 11:32315907-32315929 CATAACTACATAGTTATAATAGG + Intergenic
1085478114 11:76800397-76800419 CATAACTCCATGGTTGGATGAGG - Intergenic
1085488959 11:76896039-76896061 CATAACTCCAGGGTTTTCCCAGG - Intronic
1100063219 12:90607757-90607779 CAAAACTCAATGGTTTAAACAGG - Intergenic
1100654371 12:96624818-96624840 CATAAATCCATGCTTGAAACAGG - Intronic
1101453166 12:104800490-104800512 CATAGCCACATGGTTACAACAGG + Intergenic
1104578845 12:129994163-129994185 AATAACTGCATGGATATAATAGG - Intergenic
1111135201 13:84032728-84032750 CACAACTCCCTGGATATACCAGG - Intergenic
1115711946 14:36060740-36060762 CAAAAGTACATGGTTATAAGTGG + Intergenic
1117191435 14:53295831-53295853 AATAATTCCCTGGATATAACAGG - Intergenic
1124798764 15:32809148-32809170 CAGAACTCCATGGTCATTAAGGG - Intronic
1125848710 15:42884144-42884166 GACAAATCCGTGGTTATAACTGG + Intronic
1127558706 15:60114523-60114545 CATAAGTCCATGATTCTAAAGGG - Intergenic
1127907914 15:63390566-63390588 CATAACTCCATTTTTATGATAGG + Intergenic
1129932545 15:79424184-79424206 GATAACTCCATGGAAATAATGGG + Intronic
1130211717 15:81929794-81929816 CATAACCACATGTTTTTAACAGG + Intergenic
1130440116 15:83944977-83944999 CAAAACTACACGGTTAAAACAGG - Intronic
1130617879 15:85429687-85429709 CAAATCTGCATAGTTATAACAGG + Intronic
1138129374 16:54466640-54466662 CATAAGTGCATGGCTAGAACAGG + Intergenic
1138953601 16:61943995-61944017 CATAGCTTAATGGTAATAACTGG + Intronic
1148136731 17:45297469-45297491 CTTAACTTGATGGTTTTAACAGG + Intronic
1150142775 17:62744108-62744130 CATAACTCCATGAGTGTAACTGG - Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1158193124 18:54853751-54853773 CATCATTCCAAGCTTATAACAGG - Intronic
925737303 2:6974943-6974965 CATGATTGCTTGGTTATAACCGG + Intronic
930170309 2:48245121-48245143 GATAATTCCATGACTATAACTGG - Intergenic
935990020 2:108711224-108711246 CTTGACACCATTGTTATAACGGG - Intergenic
939398506 2:141661658-141661680 CATAACTCCATAGTTCTTGCAGG - Intronic
946686054 2:222271220-222271242 CATAAAGCCATGGTTATATCTGG + Intronic
948742917 2:240059957-240059979 CATAACTCCATGGAGCAAACTGG + Intergenic
1180634681 22:17254903-17254925 CATAACTCCAAGGCTAGGACTGG - Intergenic
1181851307 22:25751862-25751884 CTTTACTCCACGGTTAAAACCGG - Intronic
951408812 3:22336624-22336646 CAAATTTCCATGTTTATAACTGG + Intronic
952590022 3:34941138-34941160 AATAACTCCATAGTTCTCACAGG - Intergenic
960703839 3:120462870-120462892 CATGGCTCCAATGTTATAACCGG - Intergenic
965443687 3:168748006-168748028 CATAACTCTAAGGTTAAAAAAGG - Intergenic
969281925 4:6176602-6176624 GATAACTCCATGTTTACAAATGG + Intronic
973662433 4:53121810-53121832 CATAACTAATTGGTTATGACTGG + Intronic
973956375 4:56067478-56067500 CATGAATCCATGCTAATAACAGG - Intergenic
979785338 4:124710787-124710809 CATAACTCCATGGTTATAACTGG + Exonic
980664788 4:135917439-135917461 CATAACAACATGGATGTAACTGG + Intergenic
981204831 4:142027886-142027908 CATAACTGCATGCTTACACCAGG + Exonic
982568769 4:157021936-157021958 CAGAACTCTATCGTGATAACAGG + Intergenic
988597439 5:32607850-32607872 CGTAAGTCCATGGTTGTCACTGG + Intergenic
992919397 5:81498005-81498027 TATAAGGCCATGTTTATAACTGG + Intronic
994309868 5:98257343-98257365 CATAACTCACTGGTAATATCAGG - Intergenic
996204137 5:120710253-120710275 CATAGCTCCAGGGGTACAACCGG + Intergenic
1008167267 6:48153443-48153465 CATAACAACAAGCTTATAACAGG + Intergenic
1011661380 6:89597160-89597182 CATAAATCTCTGGTTATATCTGG + Intronic
1014543102 6:122699988-122700010 CAAACCTTCATGGTTTTAACTGG - Intronic
1021437089 7:20630933-20630955 CATAAATTCATGGATATTACTGG + Intronic
1024691083 7:51804170-51804192 TATAACTTCAGGGTTATAAGTGG + Intergenic
1044889406 8:96817170-96817192 CATACCTCAATGGTCTTAACTGG + Intronic
1046053583 8:109052873-109052895 CATAAATCCATGCTTATATGTGG - Intergenic
1052638841 9:31137813-31137835 CATATCTACACGGTTAAAACAGG + Intergenic
1055470029 9:76601972-76601994 CTTATCTCCATGGTCATAATGGG + Intergenic
1056480670 9:87001336-87001358 GACAAATCCATGATTATAACTGG - Intergenic
1056789142 9:89614545-89614567 CAAGACACCATGGTTTTAACTGG - Intergenic
1059297303 9:113282950-113282972 TGTAACTACATGGTTATACCAGG - Intronic
1060383996 9:123205514-123205536 CATTACTGCTTGCTTATAACTGG - Intronic
1186259766 X:7764952-7764974 CAGAAATCCATTCTTATAACAGG - Intergenic
1188562367 X:31483427-31483449 TATAATTCCATTGTTAAAACTGG + Intronic
1188636193 X:32434936-32434958 AATAACTCCCAGGTTATTACTGG + Intronic
1188765269 X:34082763-34082785 CAAATTTCCATGTTTATAACTGG + Intergenic
1189728982 X:43999138-43999160 CTTTAATCCATGCTTATAACTGG - Intergenic
1198216840 X:134563244-134563266 AAGACCTCCATGGTAATAACAGG - Intergenic
1199163226 X:144639639-144639661 CATAAATCCATGGAAATAGCAGG - Intergenic
1201508169 Y:14727597-14727619 CATCATTGCATGGGTATAACTGG + Intronic