ID: 979786244

View in Genome Browser
Species Human (GRCh38)
Location 4:124718518-124718540
Sequence TGTATCACATAAAACCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979786244_979786247 20 Left 979786244 4:124718518-124718540 CCATCCTGGTTTTATGTGATACA No data
Right 979786247 4:124718561-124718583 TAATTAGAGAAACAAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979786244 Original CRISPR TGTATCACATAAAACCAGGA TGG (reversed) Intergenic
No off target data available for this crispr