ID: 979791073

View in Genome Browser
Species Human (GRCh38)
Location 4:124781562-124781584
Sequence CTGTGGTAGGGGTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979791065_979791073 3 Left 979791065 4:124781536-124781558 CCAGCATCGTTAGAATATTGAAT No data
Right 979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979791073 Original CRISPR CTGTGGTAGGGGTGGGAAAT GGG Intergenic
No off target data available for this crispr