ID: 979795190

View in Genome Browser
Species Human (GRCh38)
Location 4:124837742-124837764
Sequence ACTGATACGCAGACTATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979795190_979795191 17 Left 979795190 4:124837742-124837764 CCTTACATAGTCTGCGTATCAGT No data
Right 979795191 4:124837782-124837804 ATAAAGACTTACCCAAGACTAGG 0: 20
1: 2236
2: 4301
3: 7957
4: 10171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979795190 Original CRISPR ACTGATACGCAGACTATGTA AGG (reversed) Intergenic
No off target data available for this crispr