ID: 979798226

View in Genome Browser
Species Human (GRCh38)
Location 4:124874197-124874219
Sequence ATTTCTCGCTTTCATCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979798223_979798226 23 Left 979798223 4:124874151-124874173 CCAAGAGAGAACTGGGGAATTTG No data
Right 979798226 4:124874197-124874219 ATTTCTCGCTTTCATCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979798226 Original CRISPR ATTTCTCGCTTTCATCTGTT TGG Intergenic
No off target data available for this crispr