ID: 979799876

View in Genome Browser
Species Human (GRCh38)
Location 4:124895038-124895060
Sequence CTGTATTAGTGGAGGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979799869_979799876 4 Left 979799869 4:124895011-124895033 CCTAGTGATAAAGACATCACCCC No data
Right 979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG No data
979799868_979799876 10 Left 979799868 4:124895005-124895027 CCACTGCCTAGTGATAAAGACAT No data
Right 979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979799876 Original CRISPR CTGTATTAGTGGAGGCAAAA TGG Intergenic
No off target data available for this crispr