ID: 979801461

View in Genome Browser
Species Human (GRCh38)
Location 4:124914177-124914199
Sequence ATAGACAAAATTGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979801461_979801464 7 Left 979801461 4:124914177-124914199 CCCACAAAGGCAATTTTGTCTAT No data
Right 979801464 4:124914207-124914229 TGTCAAATCTTGTTGCTCTTGGG No data
979801461_979801467 22 Left 979801461 4:124914177-124914199 CCCACAAAGGCAATTTTGTCTAT No data
Right 979801467 4:124914222-124914244 CTCTTGGGTGATGTAAGCAGGGG No data
979801461_979801465 20 Left 979801461 4:124914177-124914199 CCCACAAAGGCAATTTTGTCTAT No data
Right 979801465 4:124914220-124914242 TGCTCTTGGGTGATGTAAGCAGG No data
979801461_979801466 21 Left 979801461 4:124914177-124914199 CCCACAAAGGCAATTTTGTCTAT No data
Right 979801466 4:124914221-124914243 GCTCTTGGGTGATGTAAGCAGGG No data
979801461_979801463 6 Left 979801461 4:124914177-124914199 CCCACAAAGGCAATTTTGTCTAT No data
Right 979801463 4:124914206-124914228 TTGTCAAATCTTGTTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979801461 Original CRISPR ATAGACAAAATTGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr