ID: 979803356

View in Genome Browser
Species Human (GRCh38)
Location 4:124939270-124939292
Sequence CTTTATGTCATGGAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979803354_979803356 -10 Left 979803354 4:124939257-124939279 CCAGGGAAGAACACTTTATGTCA No data
Right 979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG No data
979803351_979803356 14 Left 979803351 4:124939233-124939255 CCTTCATCTTATGACTTGTATGC No data
Right 979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG No data
979803350_979803356 26 Left 979803350 4:124939221-124939243 CCTATGTGGAAACCTTCATCTTA No data
Right 979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979803356 Original CRISPR CTTTATGTCATGGAGCAGAG TGG Intergenic
No off target data available for this crispr