ID: 979805293

View in Genome Browser
Species Human (GRCh38)
Location 4:124962655-124962677
Sequence TTGCATATGAATAAGCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979805290_979805293 16 Left 979805290 4:124962616-124962638 CCATATCATATGGTAATGGGAGA No data
Right 979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG No data
979805287_979805293 21 Left 979805287 4:124962611-124962633 CCAAACCATATCATATGGTAATG No data
Right 979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979805293 Original CRISPR TTGCATATGAATAAGCATGT AGG Intergenic
No off target data available for this crispr