ID: 979807389

View in Genome Browser
Species Human (GRCh38)
Location 4:124991341-124991363
Sequence TGTTTTTCTGAATATAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979807384_979807389 12 Left 979807384 4:124991306-124991328 CCTTGTACTCTGAAGATTTCCAA No data
Right 979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG No data
979807383_979807389 16 Left 979807383 4:124991302-124991324 CCTTCCTTGTACTCTGAAGATTT No data
Right 979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG No data
979807388_979807389 -7 Left 979807388 4:124991325-124991347 CCAAGGTTTTGGGATATGTTTTT No data
Right 979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG No data
979807382_979807389 17 Left 979807382 4:124991301-124991323 CCCTTCCTTGTACTCTGAAGATT No data
Right 979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979807389 Original CRISPR TGTTTTTCTGAATATAGACA TGG Intergenic
No off target data available for this crispr