ID: 979810139

View in Genome Browser
Species Human (GRCh38)
Location 4:125026690-125026712
Sequence GGCAAAAGTCACAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979810133_979810139 30 Left 979810133 4:125026637-125026659 CCTATCAAGTTTGTTTGGCAGAG No data
Right 979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979810139 Original CRISPR GGCAAAAGTCACAGTGGGCA GGG Intergenic
No off target data available for this crispr