ID: 979821980

View in Genome Browser
Species Human (GRCh38)
Location 4:125186222-125186244
Sequence GACTGAAGGTAGATGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979821976_979821980 18 Left 979821976 4:125186181-125186203 CCTGGCCAATAAAAACAATTAAC No data
Right 979821980 4:125186222-125186244 GACTGAAGGTAGATGGTTTCAGG No data
979821975_979821980 26 Left 979821975 4:125186173-125186195 CCACTGTGCCTGGCCAATAAAAA No data
Right 979821980 4:125186222-125186244 GACTGAAGGTAGATGGTTTCAGG No data
979821977_979821980 13 Left 979821977 4:125186186-125186208 CCAATAAAAACAATTAACTATCT No data
Right 979821980 4:125186222-125186244 GACTGAAGGTAGATGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979821980 Original CRISPR GACTGAAGGTAGATGGTTTC AGG Intergenic
No off target data available for this crispr