ID: 979824339

View in Genome Browser
Species Human (GRCh38)
Location 4:125215018-125215040
Sequence GGTGAAGCACAGACAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979824336_979824339 12 Left 979824336 4:125214983-125215005 CCTAGTAGTCAAAAAGGATTTCA No data
Right 979824339 4:125215018-125215040 GGTGAAGCACAGACAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979824339 Original CRISPR GGTGAAGCACAGACAGCAGC TGG Intergenic
No off target data available for this crispr