ID: 979829230

View in Genome Browser
Species Human (GRCh38)
Location 4:125280146-125280168
Sequence AAACCCTTCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979829230_979829232 20 Left 979829230 4:125280146-125280168 CCTATCTTTGTGAAGAAGGGTTT No data
Right 979829232 4:125280189-125280211 AACGAAATTACAGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979829230 Original CRISPR AAACCCTTCTTCACAAAGAT AGG (reversed) Intergenic