ID: 979831743

View in Genome Browser
Species Human (GRCh38)
Location 4:125314233-125314255
Sequence CCAGGTGACTAGGGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979831743_979831755 -8 Left 979831743 4:125314233-125314255 CCTCCTGCCCCCTAGTCACCTGG No data
Right 979831755 4:125314248-125314270 TCACCTGGAAGGTGGGGGAGAGG No data
979831743_979831757 -6 Left 979831743 4:125314233-125314255 CCTCCTGCCCCCTAGTCACCTGG No data
Right 979831757 4:125314250-125314272 ACCTGGAAGGTGGGGGAGAGGGG No data
979831743_979831756 -7 Left 979831743 4:125314233-125314255 CCTCCTGCCCCCTAGTCACCTGG No data
Right 979831756 4:125314249-125314271 CACCTGGAAGGTGGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979831743 Original CRISPR CCAGGTGACTAGGGGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr