ID: 979832501

View in Genome Browser
Species Human (GRCh38)
Location 4:125318305-125318327
Sequence TTCCGTCTGGATCCTGTGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979832495_979832501 9 Left 979832495 4:125318273-125318295 CCTTACAAGAGGCAGAGACTGAC 0: 1
1: 0
2: 1
3: 10
4: 233
Right 979832501 4:125318305-125318327 TTCCGTCTGGATCCTGTGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979832501 Original CRISPR TTCCGTCTGGATCCTGTGTC TGG Exonic
900089972 1:915980-916002 TTCCTCCTGCATCCTCTGTCGGG + Intergenic
902601950 1:17545974-17545996 TTCAGTCTGGCTCTGGTGTCAGG + Intronic
907750124 1:57255133-57255155 TTCCCTCTGAAAACTGTGTCAGG + Intronic
910826873 1:91418508-91418530 TTCCTCCTGGATCCTCTGTCTGG - Intergenic
912299968 1:108504754-108504776 TTACTTCTGGATCATGTGTAGGG - Intergenic
914457447 1:147849260-147849282 TTCAGTCTTGATTCTGTGTGGGG - Intergenic
914901400 1:151713102-151713124 TTCCTACTGGAAGCTGTGTCAGG + Intronic
917306581 1:173631416-173631438 TTCTGTCTGGATGATCTGTCCGG - Intronic
923781891 1:237032163-237032185 TTCCGTCTGCAGTCTGTGTCTGG + Intergenic
1064669274 10:17692779-17692801 TTCCTTTTGGATCAAGTGTCAGG - Intronic
1064839328 10:19573193-19573215 TTCCTTCTGGATCCTGCCCCAGG + Intronic
1066301100 10:34097065-34097087 TTCCTTATGGATTCTCTGTCTGG - Intergenic
1075738278 10:124677605-124677627 GGCCATCTGGATCCTGAGTCGGG - Intronic
1076806561 10:132862010-132862032 GTCCAGGTGGATCCTGTGTCGGG - Intronic
1077811474 11:5642244-5642266 TTTCTTCTGGATCCAGGGTCCGG + Intronic
1091336712 11:134774859-134774881 TTCCTTGTTGATCCTCTGTCTGG - Intergenic
1095049256 12:37542264-37542286 TTCTGCCTGGGTCCTGTGGCCGG + Intergenic
1097195321 12:57239656-57239678 TTCTGTCTGCTTCCTGTCTCTGG + Intronic
1105657353 13:22455550-22455572 TTGCACCTGCATCCTGTGTCAGG - Intergenic
1106170991 13:27288412-27288434 TTCTTTCTGGTTTCTGTGTCAGG + Intergenic
1106356802 13:28991024-28991046 TTCCCTCTTGCTCTTGTGTCCGG - Intronic
1106696014 13:32173383-32173405 TTCCGACTGAATTCTGTGACTGG - Exonic
1108074900 13:46669879-46669901 TTCCATCCTGATCTTGTGTCAGG + Intronic
1109748851 13:66663640-66663662 ATGCGTCTGGTTCATGTGTCAGG - Intronic
1117102459 14:52364376-52364398 TTCCCTCTGGATTTTGAGTCTGG - Intergenic
1121698648 14:95934286-95934308 TATCGTCTGGACCCTGTGCCTGG - Intergenic
1122272964 14:100576573-100576595 CTCCGTCTCCATCCTGTGTTGGG + Intronic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG + Intergenic
1123637848 15:22376537-22376559 TTCCTTCTTGACCCTGGGTCTGG + Intergenic
1125162047 15:36655758-36655780 TTCTTTCTAGATGCTGTGTCTGG - Intronic
1130801413 15:87267403-87267425 ATCCTTCTGGATGCTATGTCTGG - Intergenic
1131161309 15:90106711-90106733 TTCCGCCAGCACCCTGTGTCAGG - Intergenic
1133830785 16:9321611-9321633 TTCCATCAGTATCCAGTGTCTGG + Intergenic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1134362740 16:13546893-13546915 TATCATCTGGCTCCTGTGTCTGG + Intergenic
1135990107 16:27213502-27213524 TTCCACCAGGAACCTGTGTCAGG - Intronic
1140032689 16:71351034-71351056 CTCCCTCTGGCTCCTGTGTAGGG - Intergenic
1141725837 16:85787788-85787810 CTCCCTCAGGATCCTGTGCCTGG + Intronic
1147584443 17:41645803-41645825 TTCCTTCTTTTTCCTGTGTCTGG + Intergenic
1147607784 17:41784263-41784285 TTCCCTCTGGAGCCTCTGTTTGG - Intronic
1152300015 17:79490103-79490125 TGCCTTCTGAATCCTGTCTCTGG + Intronic
1152382880 17:79951362-79951384 TCCCTCCTGGGTCCTGTGTCTGG - Intronic
1154100910 18:11472757-11472779 ATACGTCTGGACCCTGTCTCAGG - Intergenic
1155359594 18:24986719-24986741 TTCCATCTGAATGCTGTGTAAGG + Intergenic
1157575886 18:48742766-48742788 GTCTGTCTGGGTCCAGTGTCTGG + Intronic
1164683264 19:30150002-30150024 TGACGTGTGGGTCCTGTGTCTGG + Intergenic
1166364406 19:42271205-42271227 TGCCCTCTGGATCATGTGACAGG + Intronic
1166533265 19:43554979-43555001 ATCCCTCTGGGGCCTGTGTCAGG - Intronic
925675682 2:6358766-6358788 TTCAGTCTGACTCCTGTGCCAGG - Intergenic
926767129 2:16331207-16331229 TTGCATCTGCATCCTGTGGCAGG - Intergenic
932459200 2:71871619-71871641 TTCCTTCTGGATACTGTCTGAGG + Intergenic
937304123 2:120860716-120860738 TTCCTTATGGATCCTGGGCCTGG + Intronic
937822599 2:126327714-126327736 TTCCTTCTGCATCCTGTACCAGG + Intergenic
938409551 2:131052767-131052789 TTGCCTCTGGATCCAGGGTCAGG + Intronic
941441021 2:165536949-165536971 TTCCGTATGTATCCTGTGTATGG + Intronic
949006953 2:241655145-241655167 TTCCGTCTGGAGGCTGGGTCGGG + Intronic
1175286390 20:57839694-57839716 TTCCTTCTGGATCCTGCCCCAGG + Intergenic
1175982107 20:62743846-62743868 GGCTGTCTGGAGCCTGTGTCGGG + Intronic
1176163762 20:63662303-63662325 TTCTGTCGGGTTCCTGTGGCCGG + Intronic
1179045994 21:37845640-37845662 TTCCGTTTGGCTACTGTGTGGGG + Intronic
1183340267 22:37276403-37276425 GACCGTCTGGATCCCGAGTCTGG + Intergenic
954849014 3:53584559-53584581 TTCCTTCTGCATCCTGTCTTAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
965791477 3:172392915-172392937 TTCTGCCTGTATCCTGTATCTGG + Intronic
968590737 4:1458555-1458577 TTCCCTCTGTTCCCTGTGTCTGG + Intergenic
971187279 4:24391944-24391966 TACCTTCTGTATCCTTTGTCAGG - Intergenic
972137797 4:35914351-35914373 TTCAGTCTTGATGCTCTGTCAGG - Intergenic
978439949 4:108722953-108722975 TCTCGTTTGGATCCTGTTTCTGG + Intergenic
979832501 4:125318305-125318327 TTCCGTCTGGATCCTGTGTCTGG + Exonic
992124342 5:73625958-73625980 TTCCTCCTGGAGCCGGTGTCGGG + Intergenic
994552062 5:101247541-101247563 TTCCTGGTGGATCCAGTGTCTGG - Intergenic
996083487 5:119280511-119280533 TTCCCTCTGTTTCCTGTATCTGG + Intronic
998202198 5:140133954-140133976 TTCAGACTATATCCTGTGTCTGG + Intergenic
1003965632 6:11249862-11249884 TTCCTTCTGGCTCCTGTGTCTGG + Intronic
1006423249 6:33948581-33948603 CTCCATCAGGATCCTGTATCTGG + Intergenic
1015754301 6:136592218-136592240 TTCCGTCAGGATCCTGTGAAGGG + Exonic
1019733424 7:2639321-2639343 TGCCGCCTGGACCCTGTGCCAGG + Intronic
1021614294 7:22486810-22486832 TTCCTGGTGGATCCTGTTTCAGG + Intronic
1028148451 7:87345335-87345357 TGCCTTCTAGATCCTGGGTCAGG + Intergenic
1028483531 7:91334001-91334023 TTTAGTCTGGATCTTGTGGCTGG + Intergenic
1031926645 7:127644599-127644621 TTCCTTCTTGTTCCAGTGTCTGG + Intergenic
1032410232 7:131689202-131689224 TTCCCACAGGATCCTGTATCTGG - Intergenic
1034276116 7:149824567-149824589 CTCTGTCTGGATCCTGCGACAGG + Intergenic
1036043063 8:5107845-5107867 TACCGTCCGGAGACTGTGTCGGG + Intergenic
1037659391 8:20913899-20913921 ATCAGTCTGGATCCTGGGTGGGG - Intergenic
1039349937 8:36753047-36753069 TGCTGTCTTGATCCTGTGTAAGG + Intergenic
1041675945 8:60539910-60539932 TTTAGTATGGACCCTGTGTCAGG + Intronic
1042514581 8:69645668-69645690 TTCCTTTTCCATCCTGTGTCTGG - Intronic
1047089755 8:121560776-121560798 CTTCGTCTGGCTGCTGTGTCTGG - Intergenic
1047190693 8:122676545-122676567 CTCAGTCTGTTTCCTGTGTCTGG + Intergenic
1048147953 8:131863909-131863931 GTAAATCTGGATCCTGTGTCAGG - Intergenic
1050400791 9:5251617-5251639 TTCCTTATGGATTTTGTGTCTGG - Intergenic
1052459724 9:28747141-28747163 CTCCTTCTGGATCCTGGGTCTGG - Intergenic
1055294827 9:74823447-74823469 TTCCATGTGTATCCTGTGTCAGG + Intronic
1058083355 9:100722508-100722530 TTCTGTGTGGATCCTGTGTGGGG + Intergenic
1059073710 9:111166741-111166763 TTCCCTCTTGATGCTGGGTCTGG - Intergenic
1194521064 X:94919335-94919357 TGCTGTCTGGAGCCTTTGTCAGG + Intergenic
1194903244 X:99541526-99541548 TTCCATATGGATCATCTGTCTGG - Intergenic
1197167859 X:123398137-123398159 TTCTGTCTGGACCATGTTTCTGG - Intronic
1197380015 X:125728009-125728031 TTCTGTCTGGAGCCTCTGGCAGG - Intergenic
1200138752 X:153886963-153886985 TTCCTTCTCGATCCTGTGCAGGG - Intronic