ID: 979832532

View in Genome Browser
Species Human (GRCh38)
Location 4:125318500-125318522
Sequence CACATTAAGGAGAATGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 789}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979832530_979832532 -10 Left 979832530 4:125318487-125318509 CCAATACTTTGCTCACATTAAGG 0: 1
1: 0
2: 1
3: 7
4: 130
Right 979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 789
979832529_979832532 -5 Left 979832529 4:125318482-125318504 CCGGTCCAATACTTTGCTCACAT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 789
979832527_979832532 7 Left 979832527 4:125318470-125318492 CCTGTCTTCTACCCGGTCCAATA 0: 1
1: 0
2: 0
3: 3
4: 36
Right 979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 789
979832528_979832532 -4 Left 979832528 4:125318481-125318503 CCCGGTCCAATACTTTGCTCACA 0: 1
1: 0
2: 1
3: 7
4: 131
Right 979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 789
979832526_979832532 8 Left 979832526 4:125318469-125318491 CCCTGTCTTCTACCCGGTCCAAT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979832532 Original CRISPR CACATTAAGGAGAATGAGCC TGG Exonic
900578612 1:3396503-3396525 GTCATTAAGGACATTGAGCCAGG + Exonic
900923261 1:5687310-5687332 CACATTAGGCAAAATGAGCCTGG + Intergenic
902309772 1:15573010-15573032 CACTTTAAGGAGGCTGAGGCGGG + Exonic
902714969 1:18266432-18266454 CACATTCAGGTGGATGAGCTAGG + Intronic
902733550 1:18385411-18385433 GACAGTAAGGAGAAAGAGACTGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903525608 1:23991722-23991744 CACTTGTAGGAGAATGAGACTGG - Intergenic
905510458 1:38515337-38515359 CACATGTAGGAGAATGAAACTGG - Intergenic
906131297 1:43459237-43459259 CACATGTAGGAGAATGAAACTGG + Intergenic
906360590 1:45154537-45154559 CACATGTAGGAGAATGAAACTGG + Intronic
906876721 1:49547199-49547221 CACATGTAGGAGAATGAAACTGG - Intronic
906910903 1:49949136-49949158 CACATGTAGGAGAATGAAACTGG + Intronic
908982191 1:69972067-69972089 CACATGTAGGAGAATGAAACTGG + Intronic
909409735 1:75336265-75336287 CACATTCAGGAGGCTGAGGCAGG - Intronic
909588593 1:77319647-77319669 GACATTAAGGAAATTGGGCCTGG - Intronic
909667215 1:78148339-78148361 CACATGTAGGAGAATGAAACTGG + Intergenic
909947954 1:81684828-81684850 CACATGTAGGAGAATGAAACTGG - Intronic
910949296 1:92628525-92628547 CACATGTAGGAGAATGAAACTGG - Intronic
911031405 1:93492873-93492895 CACATTAAGAAGCATCAACCTGG - Intronic
911081110 1:93932166-93932188 CACATGTAGGAGAATGAAACTGG + Intergenic
911509880 1:98798566-98798588 CACATTAAGTGAAATAAGCCAGG - Intergenic
911678502 1:100686852-100686874 CACATGTAGGAGAATGAAACTGG - Intergenic
911847249 1:102769922-102769944 CACATGTAGGAGAATGAAACTGG - Intergenic
911873965 1:103135205-103135227 CACATGTAGGAGAATGAAACTGG - Intergenic
911971824 1:104448402-104448424 AACATTAAGGAGAAAGAGAGCGG - Intergenic
912392240 1:109311493-109311515 GCCAATAATGAGAATGAGCCAGG + Exonic
912606212 1:110992088-110992110 CACATGTAGGAGAATGAAACTGG - Intergenic
912623017 1:111184362-111184384 CATATTAAGGAGAATGGGGGTGG + Exonic
913339343 1:117742530-117742552 CACATGTAGGAGAATGAAACTGG - Intergenic
914346486 1:146803960-146803982 CACATGTAGGAGAATGAAACTGG + Intergenic
914454971 1:147827703-147827725 CACATGTAGGAGAATGAAACTGG - Intergenic
915182306 1:154072715-154072737 CACATGTAGGAGAATGAAACTGG + Intronic
916700909 1:167293902-167293924 CACATGAAGAAGAATGAAACTGG + Intronic
916753257 1:167742830-167742852 CACATGTAGGAGAATGAAACTGG - Intronic
916872753 1:168935036-168935058 CACATGTAGGAGAATGAAACTGG - Intergenic
917053785 1:170956012-170956034 CACATGCAGGAGAATGAAACTGG - Intronic
917226644 1:172790735-172790757 CAGATTTGGGAGAGTGAGCCTGG + Intergenic
918909201 1:190543636-190543658 CACATGTAGGAGAATGAAACTGG - Intergenic
918990603 1:191693690-191693712 CACATTAGGGAAAATGTCCCAGG - Intergenic
919073024 1:192779855-192779877 CACATGTAGGAGAATGAAACTGG - Intergenic
919111575 1:193226116-193226138 CACATGTAGGAGAATGAAACTGG - Intronic
919115089 1:193271674-193271696 CACATGTAGGAGAATGAAACTGG - Intergenic
919442191 1:197649663-197649685 CACATGTAGGAGAATGAAACTGG + Intronic
919514612 1:198507665-198507687 CACATGTAGGAGAATGAAACTGG - Intergenic
919549080 1:198962089-198962111 CACATGTAGGAGAATGAAACTGG - Intergenic
921956342 1:220987619-220987641 CACAGTAACATGAATGAGCCTGG - Intergenic
922377592 1:224984336-224984358 CACATGTAGGAGAATGAAACTGG + Intronic
922395573 1:225197237-225197259 CACATATAGGAGAATGAAACTGG - Intronic
922658395 1:227406366-227406388 CACATGTAGGAGAATGAAACTGG + Intergenic
922995532 1:229955845-229955867 CACATGTAGGAGAATGAAACTGG - Intergenic
923875716 1:238044733-238044755 CACATATAGGAGAATGAAACTGG + Intergenic
923945268 1:238879117-238879139 CACATATAGGAGAATGAAACTGG + Intergenic
923996720 1:239503861-239503883 CACATGTAGGAGAATGAAACTGG + Intronic
924203237 1:241682322-241682344 CACATGTAGGAGAATGAAACTGG - Intronic
924761570 1:246992271-246992293 CACGTTAAGTAAAATAAGCCAGG + Intronic
924882910 1:248182373-248182395 CACATGTAGGAGAATGAAACTGG - Intergenic
1063081191 10:2769097-2769119 CACATGTAGGAGAATGAAACTGG + Intergenic
1063869666 10:10403924-10403946 CACAGGAAAGAGAATGAGTCTGG + Intergenic
1064907721 10:20365688-20365710 CACATAAAGGAGAATGCAACTGG - Intergenic
1065470556 10:26076691-26076713 CACATGTAGGAGAATGAAACTGG - Intronic
1065523022 10:26590178-26590200 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065528937 10:26649434-26649456 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065910283 10:30297553-30297575 CACATGTAGGAGAATGAAACTGG - Intergenic
1066145115 10:32549610-32549632 CACATGTAGGAGAATGAAACAGG - Intronic
1068097806 10:52513790-52513812 CACATGTAGGAGAATGAAACTGG - Intergenic
1068436462 10:56998133-56998155 CACATACAGAAGAATGAGACTGG + Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068809162 10:61236426-61236448 CACATGTAGGAGAATGAAACTGG + Intergenic
1069150060 10:64949053-64949075 CACATGTAGGAGAATGAAACTGG - Intergenic
1069242312 10:66158348-66158370 CACATGTAGGAGAATGAAACTGG - Intronic
1069402079 10:68059093-68059115 TACATTAAGTAAAATGAGCAAGG - Intronic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1070859858 10:79644962-79644984 CACATGTAGGAGAATGAAACTGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071045599 10:81372240-81372262 CACATTTAGAAGAATGAAACTGG - Intergenic
1071456796 10:85857364-85857386 CACACTCAGGAGGCTGAGCCTGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072164278 10:92797527-92797549 CACATGTAGGAGAATGAAACTGG + Intergenic
1072380497 10:94864251-94864273 CACATGTAGGAGAATGAACCTGG - Intergenic
1072815310 10:98502494-98502516 CACATGTAGGAGAATGAAACTGG + Intronic
1072928430 10:99638236-99638258 CACATGTAGGAGAATGAAACTGG + Intergenic
1072955213 10:99882093-99882115 CACGTTAAGTGAAATGAGCCAGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074425160 10:113344298-113344320 CACATTAAGTGAAATAAGCCAGG + Intergenic
1075660208 10:124188785-124188807 CACATGTAGGAGAATGAAACTGG - Intergenic
1075982344 10:126751058-126751080 CACATGTAGGAGAATGAAACTGG - Intergenic
1077975879 11:7248525-7248547 CACATGTAGGAGAATGAAACTGG - Intronic
1078289051 11:9988207-9988229 CACATGTAGGAGAATGAAACTGG + Intronic
1078678689 11:13453755-13453777 TACATTAAGAAGAAAGAGGCTGG + Intronic
1078707045 11:13754315-13754337 CACATGTAGGAGAATGAAACGGG + Intergenic
1079712179 11:23699332-23699354 CACATGTAGGAGAATGAAACTGG + Intergenic
1080324527 11:31054780-31054802 CACATGTAGGAGAATGAAACTGG + Intronic
1080402705 11:31951824-31951846 CACATGTAGGAGAATGAAACTGG + Intronic
1080585486 11:33678036-33678058 CACATGTAGGAGAATGAAACTGG - Intergenic
1081106114 11:39071916-39071938 CACATGTAGGAGAATGAAACTGG + Intergenic
1081134759 11:39426570-39426592 CACGTTAAGTAAAATGAACCAGG + Intergenic
1081195652 11:40157204-40157226 CACATGTAGGAGAATGAAACTGG + Intronic
1081208596 11:40304201-40304223 CACCTTAAGGAAAAAGAGCTAGG - Intronic
1081417260 11:42831053-42831075 CATACTAAGTAAAATGAGCCAGG - Intergenic
1082607567 11:55260593-55260615 CACATGTAGGAGAATGAAACTGG + Intergenic
1082709312 11:56534529-56534551 TACATTAAGTAAAATAAGCCAGG - Intergenic
1083127243 11:60582788-60582810 CACATATAGGAGAATGAAACTGG + Intergenic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1086123083 11:83320712-83320734 TACATTAAGCAAAATAAGCCAGG - Intergenic
1086299704 11:85413600-85413622 CACATGTAGGAGAATGAAACTGG - Intronic
1086703052 11:89921975-89921997 CACATGTAGGAGAATGAAACTGG - Intergenic
1087219332 11:95529115-95529137 CACATATAGGAGAATGAAACTGG - Intergenic
1087469245 11:98550473-98550495 CACATGTAGGAGAATGAATCTGG + Intergenic
1087649134 11:100844243-100844265 CACATCTAGGAGAATGAAACTGG + Intronic
1088180019 11:107098662-107098684 CACATGAAGGAGAATGAAACTGG + Intergenic
1088206843 11:107402026-107402048 CACATGTAGGAGAATGAAACTGG + Intronic
1088240091 11:107764870-107764892 CACATGTAGGAGAATGAAACTGG + Intergenic
1088346294 11:108829778-108829800 CACATGTAGGAGAATGAAACTGG - Intronic
1088414212 11:109571002-109571024 CACATGTAGGAGAATGAAACTGG + Intergenic
1089107781 11:116028531-116028553 CACATATAGGAGAATGAAACTGG + Intergenic
1089569382 11:119393538-119393560 CACATATAGGAGAATGAAACTGG - Intergenic
1089943819 11:122446500-122446522 CACATGTAGGAGAATGAAACTGG - Intergenic
1090827999 11:130401439-130401461 CACCTGAAGAAGAACGAGCCAGG + Intergenic
1091210052 11:133849572-133849594 CACATGTAGGAGAATGAAACTGG - Intergenic
1092109112 12:5946210-5946232 CACTTTATAGAGAAGGAGCCTGG + Intronic
1093001647 12:14003501-14003523 CACATGTAGGAGAATGAAACTGG - Intergenic
1093524879 12:20094029-20094051 CACATGTAGGAGAATGAAACTGG + Intergenic
1093691021 12:22108951-22108973 CACATGTAGGAGAATGAAACTGG + Intronic
1093995417 12:25635928-25635950 CACATGTAGGAGAATGAAACTGG + Intronic
1094282213 12:28752966-28752988 GACATCATGGAGAATAAGCCAGG + Intergenic
1094721610 12:33070912-33070934 CACATATAGGAGAATGAAACTGG - Intergenic
1094816969 12:34197305-34197327 CACATGTAGGAGAATGAAACTGG - Intergenic
1095247667 12:39941906-39941928 CACATGTAGGAGAATGAAACTGG - Intronic
1095531641 12:43193480-43193502 CACATATAGGAGAATGAAACTGG - Intergenic
1095733112 12:45526836-45526858 CACATGTAGGAGAATGAAGCTGG + Intergenic
1096114230 12:49045919-49045941 CCCATGAAGGTGAAAGAGCCAGG - Exonic
1096348373 12:50871391-50871413 CACATGTAGGAGAATGAAACTGG + Intronic
1096379904 12:51147587-51147609 CACATGTAGGAGAATGAAACTGG + Intronic
1096961914 12:55588023-55588045 CACATGTAGGAGAATGAAACTGG + Intergenic
1097200615 12:57275263-57275285 CACATGTAGGAGAATGAAACTGG + Intronic
1097295920 12:57962717-57962739 CACATGTAGGAGAATGAAGCTGG + Intergenic
1097620843 12:61937600-61937622 CACATGTAGAAGAATGAACCTGG + Intronic
1097638947 12:62155738-62155760 CACATGTAGGAGAATGAAACTGG + Intronic
1097660156 12:62421359-62421381 CACATGTAGGAGAATGAAACTGG + Intergenic
1097760871 12:63462466-63462488 CACATGTAGGAGAATGAAACTGG + Intergenic
1098067020 12:66629247-66629269 CATATTAAAATGAATGAGCCTGG + Intronic
1098982271 12:76969740-76969762 CACATGTAGGAGAATGAAACTGG - Intergenic
1099236610 12:80090308-80090330 CATATGAAGGAGAATGAAACTGG + Intergenic
1099248079 12:80217756-80217778 CACATGAAGGAAAGTGAGCCAGG + Intronic
1099520425 12:83653775-83653797 TACATTAAGTGGAATAAGCCAGG + Intergenic
1099704132 12:86128869-86128891 CACATGTAGGAGAATGAAACTGG - Intronic
1100706701 12:97208298-97208320 CACATGTAGGAGAATGAAACTGG + Intergenic
1100951711 12:99857831-99857853 CACATGTAGGAGAATGAAACTGG + Intronic
1100989478 12:100236879-100236901 CACATGTAGGAGAATGAAACTGG - Intronic
1101053814 12:100892016-100892038 GACATTAAGTAAAATAAGCCAGG - Intronic
1101484151 12:105134707-105134729 CACATTAACTATAAGGAGCCAGG - Intronic
1101964549 12:109273552-109273574 CGCCTCACGGAGAATGAGCCTGG - Intergenic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1103271672 12:119678634-119678656 GACATTAAGTGAAATGAGCCAGG - Intronic
1104332960 12:127864816-127864838 CACATGTAGGAGAATGAAACTGG + Intergenic
1104343689 12:127976636-127976658 CACATGTAGGAGAATGAAACTGG + Intergenic
1104524532 12:129506653-129506675 CACATGTAGGAGAATGAAACTGG + Intronic
1105931210 13:25054301-25054323 CACATGTAGGAGAATGAAACTGG + Intergenic
1106937759 13:34742870-34742892 CACATGTAGGAGAATGAAACTGG - Intergenic
1107093889 13:36514348-36514370 TTCAATAAGGAGAATGAACCTGG - Intergenic
1107755575 13:43618435-43618457 CACATGTAGGAGAATGAAACTGG - Intronic
1108128452 13:47270422-47270444 CACATGTAGGAGAATGAAACTGG + Intergenic
1108469060 13:50750131-50750153 CACATATAGGAGAATGAAACTGG - Intronic
1108507708 13:51127744-51127766 TACATTAAGTGAAATGAGCCAGG + Intergenic
1108806360 13:54161652-54161674 CATAATAAGAAAAATGAGCCAGG + Intergenic
1109057962 13:57576553-57576575 CACATGTAGAAGAATGATCCTGG - Intergenic
1109200704 13:59427648-59427670 CACATGTAGGAGAATGAAACTGG + Intergenic
1109218794 13:59619472-59619494 CACATAAAGGAGAAAGAGAAAGG + Intergenic
1109555446 13:63968898-63968920 CACATATAGGAGAATGAAACTGG + Intergenic
1109617844 13:64860234-64860256 CACATGTAGGAGAATGAAACTGG - Intergenic
1109717591 13:66236397-66236419 CACATGTAGGAGAATGAAACTGG - Intergenic
1110793256 13:79608473-79608495 CACATGTAGGAGAATGAAACTGG - Intergenic
1110964952 13:81682370-81682392 CATATTAAGGAGAATGTTCAAGG - Intergenic
1110975561 13:81829567-81829589 CACATGTAGGAGAATGAAACTGG - Intergenic
1111067657 13:83117836-83117858 GACATTAAGTAAAATAAGCCAGG - Intergenic
1111747908 13:92292862-92292884 CACATGTAGGAGAATGAAACTGG - Intronic
1111759718 13:92446364-92446386 TACATTAAGTACAATGAGCCAGG - Intronic
1111849570 13:93555191-93555213 AGCATTAAGGAGAAAGAGACAGG - Intronic
1111963637 13:94838300-94838322 CACATGTAGGAGAATGAAACTGG + Intergenic
1111988831 13:95094463-95094485 CACATGTAGGAGAATGAAACTGG + Intronic
1112087395 13:96046279-96046301 CACATGTAGGAGAATGAAACTGG + Intronic
1112553565 13:100445682-100445704 TACATTAAGTAAAATAAGCCAGG - Intronic
1112590095 13:100755075-100755097 CACATTTAGAAAACTGAGCCAGG + Intergenic
1112747718 13:102545964-102545986 CACATGTAGGAGAATGAAACTGG + Intergenic
1112891086 13:104232323-104232345 CACATGCAGGAGAATGAAACTGG - Intergenic
1113317851 13:109202991-109203013 CACATATAGGAGAATGAAACTGG + Intronic
1113511983 13:110863702-110863724 CACATTAAAGAAAAAAAGCCAGG - Intergenic
1113534518 13:111054288-111054310 CACATGTAGGAGAATGAAACTGG - Intergenic
1114567895 14:23645864-23645886 AACATTAAGAAGTATTAGCCTGG - Intergenic
1114906499 14:27134542-27134564 CACATGCAGAAGAATGAGGCTGG + Intergenic
1114961121 14:27891086-27891108 CACATGTAGGAGAATGAAACTGG + Intergenic
1115835217 14:37394961-37394983 CACATGTAGGAGAATGAAACTGG - Intronic
1115959079 14:38814507-38814529 CACATGTAGGAGAATGAAGCTGG + Intergenic
1116117636 14:40677014-40677036 CACATGTAGGAGAATGAAACTGG + Intergenic
1116284260 14:42951468-42951490 CACATGCAGAAGAATGAGACTGG - Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116732399 14:48640636-48640658 CACATATAGGAGAATGAAACTGG + Intergenic
1116753652 14:48918644-48918666 CACATGAAGAAGAATGAAACTGG + Intergenic
1116896129 14:50316590-50316612 CACATGTAGGAGAATGAAACTGG - Intronic
1117113173 14:52480106-52480128 CACATGTAGGAGAATGAAACTGG + Intronic
1117652805 14:57924420-57924442 GAAAGTAAAGAGAATGAGCCTGG - Intronic
1118162717 14:63306731-63306753 CAAATGTAGGAGAATGAGACTGG + Intergenic
1118679158 14:68221485-68221507 CACATGTAGGAGAATGAAACTGG + Intronic
1119098878 14:71860898-71860920 CACATGTAGGAGAATGAAACTGG + Intergenic
1119653037 14:76397134-76397156 CACATCAAAGAGAGTGCGCCTGG + Intronic
1120469498 14:84904240-84904262 CACATGTTGGAGAAGGAGCCTGG + Intergenic
1120815939 14:88858206-88858228 CACTTTAAGGAGGCTGAGGCGGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121503067 14:94454242-94454264 CACATGTAGGAGAATGAAACTGG - Intergenic
1122434584 14:101686191-101686213 CACATTAAGTAAAATAAGCCAGG + Intergenic
1123998371 15:25734289-25734311 CACACCAAGGACAATGAGCTAGG + Intronic
1124381126 15:29167113-29167135 CACATGTAGGAGAATGAAACTGG + Intronic
1124387120 15:29218760-29218782 CACATGTAGGAGAATGAAACTGG + Intronic
1124557534 15:30740804-30740826 CACATGTAGGAGAATGAAACAGG + Intronic
1124668267 15:31613089-31613111 CACATGTAGGAGAATGAAACAGG + Intronic
1124806679 15:32890934-32890956 CACATGTAGGAGAATGAAACTGG - Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125273054 15:37961237-37961259 CACATGTAGGAGAATGAAACTGG - Intronic
1125377432 15:39045515-39045537 CACATGCAGGAGAATGAAACCGG + Intergenic
1125477241 15:40055532-40055554 CACCTTCAGGAGCATTAGCCTGG + Intergenic
1126060056 15:44772066-44772088 CACATGTAGGAGAATGAATCTGG - Intergenic
1126184273 15:45815739-45815761 CACATGTAGGAGAATGAAACTGG - Intergenic
1126247936 15:46531596-46531618 CACATGTAGGAGAATGAAACTGG + Intergenic
1126351592 15:47750225-47750247 GATATTGAGGAGAAAGAGCCTGG + Intronic
1126460381 15:48908747-48908769 CACATGTAGGAGAATGAAACTGG - Intronic
1126928569 15:53620592-53620614 CACATGAAGGTGAATGAAACTGG + Intronic
1126991701 15:54385418-54385440 TACATTAAGTACAATAAGCCAGG + Intronic
1127007784 15:54589985-54590007 CACATGTAGGAGAATGAAACTGG - Intronic
1127194868 15:56573312-56573334 CACATGTAGGAGAATGAAACTGG + Intergenic
1127525196 15:59786025-59786047 CACATGGAGGAGAATGAAACTGG + Intergenic
1127539492 15:59922706-59922728 CATATTAAGGACTCTGAGCCCGG - Intergenic
1127628964 15:60807870-60807892 CACATGTAGGAGAATGAAACTGG + Intronic
1128415472 15:67441681-67441703 CACATTTAGGAGAGTGAAACTGG + Intronic
1128517838 15:68354380-68354402 CACGTTAAAAAAAATGAGCCTGG - Intronic
1129096496 15:73214468-73214490 CACATGTAGGAGAATGAAACTGG - Intronic
1129555981 15:76510020-76510042 CACATGTAGGAGAATGAAACTGG + Intronic
1129648830 15:77464812-77464834 CACACAAAGGCGTATGAGCCTGG + Intronic
1129928660 15:79389286-79389308 CACATGTAGGAGAATGAAACTGG - Intronic
1130605302 15:85310822-85310844 CACATTTAGAAGAATGAAACTGG + Intergenic
1130733660 15:86525658-86525680 CACATGTAGAAGAATGAACCTGG + Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130815240 15:87425005-87425027 AAGATTCAGAAGAATGAGCCTGG - Intergenic
1130852394 15:87807498-87807520 CACATGTAGGAGAATGAAACTGG - Intergenic
1131760843 15:95620947-95620969 CACATTCAGAAGAATGAGATGGG - Intergenic
1132209885 15:100012581-100012603 CACATGTAGGAGAATGAAACTGG - Intronic
1133952677 16:10409774-10409796 CACATGTAGGAGAATGAAACTGG - Intronic
1134333943 16:13277111-13277133 CACATGTAGGAGAATGAAACTGG - Intergenic
1134557277 16:15176311-15176333 CCCATTAAGCAAAATAAGCCAGG + Intergenic
1134917852 16:18088020-18088042 CCCATTAAGCAAAATAAGCCAGG + Intergenic
1135215854 16:20569260-20569282 CACATGTAGGAGAATGAAACTGG - Intronic
1135508795 16:23063094-23063116 CACATTAACTAGAATCAGCTGGG - Exonic
1136182391 16:28562654-28562676 CACTTTAAGGAGGCTGAGGCGGG + Intronic
1136642027 16:31574737-31574759 CACATTATGTAAAATAAGCCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138558969 16:57788738-57788760 CACGTGAAGGAGACTGTGCCAGG + Intronic
1138919080 16:61504641-61504663 CACAGTAAGTAAAATGAACCAGG + Intergenic
1139057663 16:63205352-63205374 TACTTTAAGGAGAATTAGCAAGG - Intergenic
1139336821 16:66238216-66238238 CATGTTAAGGGGACTGAGCCAGG + Intergenic
1139509395 16:67418102-67418124 CACTTTAAGGAGGCTGAGGCAGG + Intergenic
1139695895 16:68674572-68674594 AAAATTAAGGAAAATTAGCCGGG + Intronic
1139987494 16:70911308-70911330 CACATGTAGGAGAATGAAACTGG - Intronic
1140425615 16:74858716-74858738 CACATTAAGTAGAATTCTCCAGG - Intergenic
1142910397 17:3084748-3084770 CACATACAGGAGAATGAAACTGG - Intergenic
1143543898 17:7585288-7585310 CACTTTAAGGAGGCTGAGGCAGG + Intronic
1144139252 17:12332029-12332051 CACATGTAGGAGAATGAAACTGG - Intergenic
1144616516 17:16780050-16780072 CACATTTAGGAGAATGAAACTGG + Intronic
1144896180 17:18535609-18535631 CACATTTAGGAGAATGAAACTGG - Intergenic
1145136033 17:20408611-20408633 CACATTTAGGAGAATGAAACTGG + Intergenic
1145356045 17:22153335-22153357 CACATTGAGAAGAATGAAGCTGG + Intergenic
1146150834 17:30469513-30469535 CACATGAAGGAAAATGATGCTGG - Exonic
1146723931 17:35142286-35142308 CACGTGGAGGAGAAAGAGCCCGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149122011 17:53180575-53180597 CACATGTAGGAGAATGAAACTGG - Intergenic
1149410497 17:56400784-56400806 CACATGTAGGAGAATGAAACTGG - Intronic
1150539135 17:66078065-66078087 CACATGTAGGAGAATGAAACTGG - Intronic
1150817702 17:68407066-68407088 CACATGTAGGAGAATGAAACTGG - Intronic
1150945087 17:69736717-69736739 CACATGTAGGAGAATGAAACTGG - Intergenic
1151266306 17:72958160-72958182 CACATATAGGAGAATGAAACTGG + Intronic
1152172105 17:78758364-78758386 CCCATTGAGGAGAAGAAGCCTGG + Intronic
1153069092 18:1084747-1084769 CACATGTAGGAGAATGAAACTGG - Intergenic
1153079512 18:1205979-1206001 CACATGTAGGAGAATGAAACTGG - Intergenic
1153148744 18:2065324-2065346 TATATTAAGTAAAATGAGCCAGG + Intergenic
1153165310 18:2254989-2255011 CACATGTAGGAGAATGAAACAGG + Intergenic
1153464544 18:5374689-5374711 TACATTAAGCAGAATGACCATGG - Intergenic
1153585917 18:6620146-6620168 CATATTAAGTAAAATAAGCCAGG + Intergenic
1153788766 18:8558334-8558356 CAGATTCAGGAGAATCAGCCAGG - Intergenic
1153921593 18:9795185-9795207 CACATGTAGGAGAATGAAACTGG + Intronic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1156667886 18:39430212-39430234 CACATGTAGGAGAATTAGGCTGG + Intergenic
1157685951 18:49642673-49642695 TACATTAAGTAAAATAAGCCAGG - Intergenic
1157734867 18:50038373-50038395 CACATAAAGGGGAAAGGGCCAGG + Intronic
1158338531 18:56439733-56439755 CACATGGAGGAGAATGAAACTGG + Intergenic
1158756916 18:60336272-60336294 CACATGTAGGAGAATGAAACTGG + Intergenic
1158793080 18:60805784-60805806 CACATTCCAGAGAATAAGCCTGG + Intergenic
1158794157 18:60821913-60821935 CACATGTAGGAGAATGAAACTGG - Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1160267113 18:77348357-77348379 CACATATAGGAGAATGAAACTGG - Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1161432202 19:4239210-4239232 CAAATTAATGAAAATGGGCCGGG + Intergenic
1162941479 19:14012331-14012353 CACATGTAGGAGAATGAAACTGG + Intergenic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164298808 19:23940212-23940234 CACATGTAGGAGAATGAAACTGG - Intronic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1166571918 19:43802428-43802450 CTCAGTAAGGAGAACCAGCCAGG - Exonic
1166574431 19:43824441-43824463 CACATGTAGGAGAATGAAACTGG + Intronic
1166603834 19:44122192-44122214 CACATGTAGGAGAATGAAACTGG - Intronic
1167204444 19:48091127-48091149 AACATTAAGCAGAAGGACCCAGG - Intronic
1168398641 19:56069719-56069741 TACATTAAATAAAATGAGCCAGG + Intergenic
925343464 2:3152467-3152489 CACATGTAGGAGAATGAAACTGG + Intergenic
925446798 2:3933320-3933342 CACATTTAGAAGAATGAAACTGG - Intergenic
925876726 2:8317557-8317579 GACACTAACGAGAATGAGCTGGG + Intergenic
929009879 2:37430603-37430625 CACATGTAGGAGAATGAAACTGG - Intergenic
929036920 2:37702412-37702434 CACATGTAGGAGAATGAAACTGG - Intronic
929387174 2:41423373-41423395 CACATGTAGGAGAATGAAACTGG - Intergenic
931524686 2:63140009-63140031 CACATGTAGGAGAATGAAACTGG - Intronic
932100149 2:68891503-68891525 CACATGTAGGAGAATGAAACTGG - Intergenic
932384470 2:71318603-71318625 CACATGTAGGAGAATGAAACTGG - Intronic
932400898 2:71480630-71480652 CTCATTAAGGAGAGTCAGCCTGG + Intronic
932653566 2:73586443-73586465 CACATATAGGAGAATGAAACTGG - Intronic
933920184 2:87038094-87038116 CACATTCAAAAGAATGAGGCTGG + Intergenic
933931440 2:87155692-87155714 CACATTCAAAAGAATGAGGCTGG - Intergenic
934002814 2:87731799-87731821 CACATTCAAAAGAATGAGGCTGG - Intergenic
934044176 2:88158291-88158313 CACATGTAGGAGAATGAAACTGG - Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934954678 2:98607995-98608017 GACATAAAGGAGAATAAGCCAGG - Intronic
935467610 2:103417407-103417429 CACATGCAGGAGAATGAAACTGG + Intergenic
935838155 2:107077769-107077791 AACATTAAGGAGACTGAGGCAGG - Intergenic
936361680 2:111809747-111809769 CACATTCAAAAGAATGAGGCTGG + Intronic
936517307 2:113190210-113190232 CACAAGAAGGAGAATGACACTGG - Intronic
936555259 2:113491441-113491463 CACATGTAGGAGAATGAAACTGG + Intronic
937573143 2:123388468-123388490 CACATGTAGGAGAATGAAACTGG + Intergenic
938012582 2:127840600-127840622 CACATAAAGAAGCATGAGGCCGG - Intergenic
938037601 2:128048458-128048480 CACATGTAGGAGAATGAAACAGG - Intergenic
938216126 2:129517724-129517746 CACATGTAGGAGAATGAAACTGG - Intergenic
938551726 2:132388699-132388721 CACATGTAGGAGAATGAAACTGG - Intergenic
938944225 2:136196592-136196614 TACATTAAGTGGAATAAGCCAGG - Intergenic
939056765 2:137374406-137374428 CACATTAAGGACAAAGAGAATGG - Intronic
939230252 2:139415102-139415124 CACATGTAGGAGAATGAAGCTGG - Intergenic
939651001 2:144761870-144761892 CACATGTAGGAGAATGAAACTGG + Intergenic
939703398 2:145421557-145421579 GACAGGAAGGAGAATGAGCACGG + Intergenic
939919506 2:148091602-148091624 CACATTTAGAAGAATGAAGCTGG + Intronic
939998253 2:148940483-148940505 CACATTAAGGATAATGGATCAGG + Intronic
940056550 2:149518862-149518884 CACATGTAGGAGAATGAAACTGG + Intergenic
940157206 2:150670234-150670256 CACATGTAGGAGAATGAAACTGG + Intergenic
940171968 2:150838565-150838587 CACATGTAGGAGAATGAAACTGG - Intergenic
940680730 2:156781730-156781752 CACATGTAGGAGAATGAAACTGG + Intergenic
940762812 2:157756109-157756131 CACATGTAGGAGAATGAAACTGG + Intronic
940796430 2:158084690-158084712 CACATGTAGGAGAATGAAACTGG - Intronic
941419381 2:165263425-165263447 CACATGTAGGAGAATGAAACTGG - Intronic
941631238 2:167886965-167886987 CACATGTAGGAGAATGAAACTGG - Intergenic
941702521 2:168619157-168619179 CACATGTAGGAGAATGAAACTGG + Intronic
941915347 2:170809280-170809302 AACATGAAGTAGAATGGGCCAGG - Intergenic
942154326 2:173111620-173111642 CACATGTAGGAGAATGAAACTGG - Intronic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
942739386 2:179157018-179157040 CACATGTAGGAGAATGAAACTGG - Intronic
943292728 2:186095410-186095432 AACATTATGGAGAGTGAGCTAGG - Intergenic
943342635 2:186698899-186698921 GACATTAAGTAAAATAAGCCAGG - Intronic
943654693 2:190495787-190495809 CACATGTAGGAGAATGAAACTGG + Intronic
943890895 2:193285752-193285774 CACATGTAGGAGAATGAAACTGG - Intergenic
943909689 2:193547300-193547322 CACATGAAGGAGAATGAATCTGG + Intergenic
943996316 2:194770524-194770546 CACATGTAGGAGAATGAAACTGG - Intergenic
944027927 2:195194355-195194377 CACATGAAGAAGAATGAAACTGG + Intergenic
944360375 2:198847752-198847774 CACATGTAGGAGAATGAAACTGG + Intergenic
944421110 2:199531260-199531282 CACATGTAGGAGAATGAAACTGG + Intergenic
944602518 2:201318040-201318062 CACATGTAGGAGAATGAAACTGG + Intronic
944772000 2:202923920-202923942 CACATGTAGGAGAATGAAACTGG + Intronic
944934405 2:204552695-204552717 CACATGTAGGAGAATGAAGCTGG - Intronic
945075562 2:206035533-206035555 CACATGTAGGAGAATGAAACCGG + Intronic
945131601 2:206579430-206579452 CACATGTAGGAGAATGAAACTGG - Intronic
945391505 2:209270900-209270922 CACATGTAGGAGAATGAAACTGG - Intergenic
945477132 2:210296898-210296920 CATGTTAAGTAAAATGAGCCAGG - Intronic
945865191 2:215166578-215166600 CACATGTAGGAGAATGAAACTGG + Intergenic
946745230 2:222838839-222838861 GGCATTAATGACAATGAGCCTGG + Intergenic
946824460 2:223662598-223662620 CACATGTAGGAGAATGAAACTGG + Intergenic
947456645 2:230260639-230260661 CACATGTAGGAGAATGAAACTGG - Intronic
948065011 2:235071426-235071448 CACATGTAGGAGAATGAAACTGG + Intergenic
948826835 2:240577090-240577112 CACATTCTGGAGAATGGGGCGGG + Intronic
1168945492 20:1752315-1752337 CACATGTAGGGGAATGAGACTGG + Intergenic
1169401784 20:5287749-5287771 CACATGTAGGAGAATGACACTGG + Intergenic
1169681293 20:8216956-8216978 CACATTTGGGAGAATGTCCCTGG - Intronic
1169707546 20:8522573-8522595 CAAATTAAGGAAAATGAGTTTGG + Intronic
1169817493 20:9673197-9673219 CACATTAAGGATTAGGTGCCAGG - Intronic
1170125127 20:12954302-12954324 CACATGTAGGAGAATGAAACTGG + Intergenic
1170862739 20:20123449-20123471 CACATGTAGGAGAATGAAACTGG - Intronic
1171160059 20:22913734-22913756 CACATGTAGGAGAATGAAACTGG - Intergenic
1171165998 20:22972003-22972025 CACATGTAGGAGAATGAAACTGG + Intergenic
1171375127 20:24687774-24687796 CACATGTAGGAGAATGAAACTGG - Intergenic
1172397397 20:34618451-34618473 CACACTAATGAGAGTGAGCATGG - Intronic
1173415199 20:42849010-42849032 CACATGTAGGAGAATGAAACTGG - Intronic
1173418073 20:42876428-42876450 CACATTCATGAGAGTGTGCCAGG + Intronic
1174384658 20:50179986-50180008 GACATTCAGGAGATTGAGGCAGG - Intergenic
1174600695 20:51722135-51722157 CACATGTAGGAGAATGAAACTGG + Intronic
1175069480 20:56320650-56320672 CACATGTAGGAGAATGAAACTGG + Intergenic
1175474713 20:59263562-59263584 CACCTCGAGGAGAAAGAGCCAGG + Intergenic
1175645244 20:60665258-60665280 CACATGTAGGAGAATGAAACTGG - Intergenic
1175865744 20:62175422-62175444 CTCCTAGAGGAGAATGAGCCAGG + Intronic
1177070361 21:16498208-16498230 CACATGTAGGAGAATGAAACTGG - Intergenic
1177174033 21:17684689-17684711 CACATGTAGGAGAATGAAACTGG - Intergenic
1177367790 21:20159897-20159919 CACATGCAGGAGAATGAAACTGG + Intergenic
1177503130 21:21984788-21984810 CACATGAAGGTGAATGAAACTGG + Intergenic
1178464001 21:32829828-32829850 CACATTTAGGAGAATGTTCATGG - Intergenic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179933454 21:44587819-44587841 CACATATAGGAGAATGAAACTGG + Intronic
1180251151 21:46590222-46590244 CACATGTAGGAGAATGAAACTGG + Intergenic
1180781257 22:18521137-18521159 CACATTAGAGAGGATCAGCCTGG - Intergenic
1181182063 22:21075356-21075378 GACCTTGAAGAGAATGAGCCAGG - Intergenic
1181238142 22:21460479-21460501 CACATTAGAGAGGATCAGCCTGG - Intergenic
1181913655 22:26261428-26261450 CACATGTAGGAGAATGAAACTGG - Intronic
1183047950 22:35235947-35235969 CACATGTAGGAGAATGAAACTGG - Intergenic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1184338565 22:43871605-43871627 CACATGTAGGAGAATGAAACTGG - Intergenic
949109426 3:240792-240814 CACATGTAGGAGAATGAAACTGG - Intronic
949208941 3:1474916-1474938 CACATGTAGGAGAATGAAACTGG + Intergenic
949667867 3:6362127-6362149 CACATACAGAAGAATGAACCTGG + Intergenic
950598837 3:14012598-14012620 CACATATAGGAGAATGAAACTGG - Intronic
951444065 3:22756430-22756452 CACATGTAGGAGAATGAAACTGG + Intergenic
951463363 3:22975112-22975134 CACATGTAGGAGAATGAAACTGG + Intergenic
951761445 3:26151707-26151729 CACATGTAGGAGAATGAAACTGG + Intergenic
952097014 3:29965924-29965946 CACATGTAGGAGAATGAAACTGG - Intronic
952522062 3:34171120-34171142 CACATTAGGGACAATGAAGCAGG + Intergenic
952689454 3:36187610-36187632 CACATGTAGGAGAATGAAACTGG - Intergenic
953495661 3:43384714-43384736 CACATGTAGAAGAATGAGACTGG + Intronic
953723348 3:45375874-45375896 CACATGTAGGAGAATGAAACTGG - Intergenic
953866939 3:46592133-46592155 CACATGCAGGAGAATGAAACTGG + Intronic
955175227 3:56606838-56606860 CACATATAGGAGAATGAAACTGG - Intronic
956815863 3:72907692-72907714 CACATTAATGAGAAACAGGCAGG - Intronic
956950665 3:74278552-74278574 CACATGTAGGAGAATGAAACTGG + Intronic
956990603 3:74758840-74758862 CACATTTAGGAGAATGAAACTGG + Intergenic
956995253 3:74819823-74819845 CACATGTAGGAGAATGAAACTGG - Intergenic
957015828 3:75064014-75064036 CACATATAGGAGAATGAAACTGG - Intergenic
958557666 3:95701336-95701358 TACATTAAGTAAAATAAGCCAGG + Intergenic
959006255 3:101023486-101023508 CACATGAAGAAGAATGAAACTGG - Intergenic
959034538 3:101345712-101345734 CACATGTAGGAGAATGAAACTGG + Intronic
959039933 3:101409730-101409752 CACATGTAGGAGAATGAAACTGG + Intronic
959131893 3:102366448-102366470 CACATGTAGGAGAATGAAACTGG - Intronic
959713043 3:109403863-109403885 CACAATTAGGAAAATTAGCCAGG - Intergenic
959715294 3:109426275-109426297 CACATGTAGGAGAATGAAACTGG - Intergenic
959720014 3:109475865-109475887 CACATGAAAAAGAATGAGTCTGG - Intergenic
959765660 3:110024304-110024326 CACATGTAGGAGAATGAAGCTGG + Intergenic
959802140 3:110507975-110507997 CACATGTAGGAGAATGAAACTGG - Intergenic
959998483 3:112704707-112704729 CACATGTAGGAGAATGAAACTGG + Intergenic
960498679 3:118408355-118408377 CACCTGATGGAGACTGAGCCAGG - Intergenic
960782985 3:121340750-121340772 TACATTAAGTAGAAAGACCCAGG + Intronic
961264247 3:125628169-125628191 CACATGTAGGAGAATGAAGCTGG - Intergenic
961702541 3:128757631-128757653 CCCAGTTAGGAGAATGAGGCAGG - Intronic
962144607 3:132827143-132827165 CACATGAAGAAGAATGAATCTGG + Intergenic
962401450 3:135062882-135062904 CACATATAGGAGAATGAAGCTGG - Intronic
962870589 3:139487724-139487746 CACATGTAGGAGAATGAAACTGG - Intergenic
963060184 3:141219487-141219509 CACATAGAGGAAAATGACCCTGG + Intergenic
963176661 3:142304752-142304774 CACATGTAGGAGAATGAAACTGG + Intergenic
963348268 3:144122547-144122569 CACCTTAACGAGAAACAGCCTGG - Intergenic
964252790 3:154739079-154739101 CACATGTAGGAGAATGAAACTGG - Intergenic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
964430106 3:156596600-156596622 CACATGTAGGAGAATGAAACTGG + Intergenic
964540726 3:157776281-157776303 CACATAAAGGAGAATGATCGGGG + Intergenic
965065956 3:163849194-163849216 CACATGTAGGAGAATGAAACTGG + Intergenic
965216451 3:165870364-165870386 CACATGTAGGAGAATGAAACCGG - Intergenic
965352906 3:167637189-167637211 CACATGTAGGAGAATGAAACTGG - Intronic
965712617 3:171571132-171571154 CACATGTAGGAGAATGAAACAGG - Intergenic
966020699 3:175205390-175205412 CACATGTAGGAGAATGAAACTGG + Intronic
966117294 3:176480691-176480713 CACATGTAGGAGAATGAAACTGG - Intergenic
966564440 3:181360818-181360840 CACATTAAGGAGAATGTAAAGGG + Intergenic
967324711 3:188227776-188227798 CCCATTTAGGGGAAAGAGCCTGG + Intronic
967400174 3:189051889-189051911 CACATGTAGGAGAATGAAACTGG + Intronic
967505537 3:190249086-190249108 CACATGTAGGAGAATGAAACTGG - Intergenic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
967559285 3:190899493-190899515 CACATATAGGAGAATGAAACTGG + Intergenic
967741172 3:193003929-193003951 CACATGTAGGAGAATGAAACTGG - Intergenic
968268105 3:197378163-197378185 GACGATGAGGAGAATGAGCCAGG - Intergenic
969375920 4:6763092-6763114 CTCATCCAGGAGAAGGAGCCAGG - Intergenic
969434903 4:7183388-7183410 CACGTAAAGGAGAAAGTGCCTGG - Intergenic
970284047 4:14489508-14489530 CACATGTAGGAGAATGAAACTGG + Intergenic
970346323 4:15155886-15155908 CACATGTAGGAGAATGAAACTGG - Intergenic
971182710 4:24344950-24344972 CACATGTAGGAGAATGAAACTGG - Intergenic
971276301 4:25200702-25200724 CACATACAGGAGAATGAAACTGG + Intronic
971694092 4:29875279-29875301 CACATGTAGGAGAATGAAACTGG - Intergenic
972049199 4:34707032-34707054 CACATGTAGGAGAATGAAACTGG + Intergenic
972188671 4:36564137-36564159 CACATGTAGGAGAATGAAACTGG - Intergenic
972955842 4:44390332-44390354 CACATGTAGGAGAATGAAACTGG - Intronic
974156492 4:58080101-58080123 CATTTTAAGAATAATGAGCCAGG - Intergenic
974202622 4:58661174-58661196 TACATGAAAGAGAATTAGCCTGG - Intergenic
974276742 4:59730140-59730162 CACATGTAGGAGAATGAAACTGG + Intergenic
974461602 4:62195809-62195831 CACAAAAACAAGAATGAGCCTGG - Intergenic
974815790 4:67001832-67001854 CACGTGAAGGAGAATGAAACTGG - Intergenic
974951322 4:68586085-68586107 CACATGTAGGAGAATGAAACTGG + Intronic
975061700 4:70011049-70011071 CACATGTAGGAGAATGAAACTGG - Intergenic
975517698 4:75265115-75265137 CACATGTAGGAGAATGAAACTGG + Intergenic
975840440 4:78468270-78468292 CACATGCAGAAGAATGAACCTGG - Intronic
976984237 4:91272791-91272813 CACATGTAGGAGAATGAAACTGG - Intronic
977089717 4:92655087-92655109 CACATGCAGAAGAATGAGACTGG - Intronic
977428174 4:96896364-96896386 TACATTGAGGAGAAAGAGCAGGG + Intergenic
977432673 4:96951936-96951958 CATATTAAGTAAAATAAGCCAGG + Intergenic
977825935 4:101531647-101531669 CACATGCAGGAGAATGAAACTGG - Intronic
978056231 4:104271062-104271084 CACATTGAGGAAAATGACCAAGG + Intergenic
978214075 4:106176447-106176469 CACATTAAGTGAAATAAGCCAGG - Intronic
978305747 4:107326810-107326832 CAAATTAAGAAGAATGAAACTGG - Intergenic
978397771 4:108300244-108300266 CACATGTAGGAGAATGAAACTGG - Intergenic
978999039 4:115194948-115194970 CACATGTAGGAGAATGAAACTGG - Intergenic
979381689 4:120013891-120013913 CACATGTAGGAGAATGAAACTGG - Intergenic
979435135 4:120679270-120679292 CACATGTAGGAGAATGAAACTGG + Intergenic
979509865 4:121540193-121540215 CACATGTAGGAGAATGAAACTGG - Intergenic
979705907 4:123720321-123720343 CACATGTAGGAGAATGAAACTGG + Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
979887502 4:126047681-126047703 CACATGTAGGAGAATGAAACTGG - Intergenic
980086800 4:128399338-128399360 CACATGTAGGAGAATGAAACTGG - Intergenic
981266490 4:142790025-142790047 CACATGTAGGAGAATGAAACTGG + Intronic
981559812 4:146034682-146034704 CACATGTAGGAGAATGAAACTGG + Intergenic
981825244 4:148933109-148933131 CACATGTAGGAGAATGAAACTGG + Intergenic
982115609 4:152096198-152096220 CTCATGAAGGAAAGTGAGCCAGG + Intergenic
982531593 4:156551517-156551539 CACATTTAGGAGAAAGAAACCGG - Intergenic
982699366 4:158642553-158642575 TACATTAAGTGGAATAAGCCAGG - Intronic
983052675 4:163067133-163067155 CACATGTAGGAGAATGAAACTGG + Intergenic
983175299 4:164581177-164581199 CACATGTAGGAGAATGAAACTGG - Intergenic
983424068 4:167559708-167559730 CACATGCAGGAGAATGAAACTGG - Intergenic
983457181 4:167979887-167979909 TACATTAAGTAAAATAAGCCAGG + Intergenic
984303896 4:177962278-177962300 CACCTTAAGGAGAAAGTGCATGG + Intronic
984488206 4:180399454-180399476 CATTTTAAGAAGAATGATCCTGG + Intergenic
985008270 4:185556550-185556572 CACATGTAGGAGAATGAAACTGG - Intergenic
985217602 4:187671022-187671044 CACATGTAGGAGAATGAAACTGG - Intergenic
986362780 5:6997557-6997579 CACATGTAGGAGAATGAAACTGG - Intergenic
986870635 5:12041273-12041295 CACATGCAGGAGAATGAAACTGG + Intergenic
987328019 5:16829942-16829964 TACATTAAGGAAAACCAGCCAGG + Intronic
988134753 5:27156856-27156878 CACATGATGGAGAAGCAGCCTGG + Intergenic
988424053 5:31041941-31041963 CACATGTAGGAGAATGAACCTGG + Intergenic
988929324 5:36020630-36020652 CACATGAAGAAGAATGAAACTGG - Intergenic
989375629 5:40756943-40756965 CACAGTAAGAAAAATGGGCCGGG + Intergenic
989378887 5:40794684-40794706 CACATGTAGGAGAATGAAACTGG - Intronic
990056144 5:51581176-51581198 CAAATGTAGGAGAATGAACCAGG + Intergenic
990233741 5:53743815-53743837 CACATGTAGGAGAATGAAACTGG + Intergenic
990458220 5:56009358-56009380 TACATTAAGGATAGTGTGCCTGG - Intergenic
990465881 5:56070884-56070906 CACTTTAAAAAGAATGAGACTGG - Intergenic
990602371 5:57372292-57372314 CACATGAAGAAGAATGAAACTGG - Intergenic
990712428 5:58600045-58600067 CACATGTAGGAGAATGAAACTGG - Intronic
992523729 5:77584767-77584789 CACATGTAGGAGAATGAAACTGG + Intronic
992777236 5:80099030-80099052 CACCCTCAGGAGAATGGGCCAGG + Intergenic
993015814 5:82533291-82533313 CACATGAAGGAGCATGAGCATGG + Intergenic
993799695 5:92317495-92317517 ATCATTAAGGAGATTGAGCAGGG + Intergenic
993883482 5:93390303-93390325 CACATGTAGGAGAATGAAACTGG - Intergenic
993917460 5:93760696-93760718 CACATGTAGGAGAATGAAACTGG + Intronic
993965213 5:94351870-94351892 CACATGTAGGAGAATGAAACTGG + Intronic
994050911 5:95361205-95361227 CACATACAGGAGAATGAAACTGG - Intergenic
994600387 5:101895083-101895105 AACATTAAGGAGAATAAGCAGGG - Intergenic
994659403 5:102635498-102635520 CACATGTAGGAGAATGAAACTGG + Intergenic
994777748 5:104056543-104056565 CACATGTAGAAGAATGAGACTGG - Intergenic
994823612 5:104683792-104683814 CACATGTAGGAGAATGAAACTGG + Intergenic
994875703 5:105418323-105418345 CACATATAGGAGAATGAAACTGG + Intergenic
994887720 5:105586276-105586298 CACATGTAGGAGAATGAAACTGG + Intergenic
995097643 5:108257969-108257991 CACATTAAGGATGCTGAGGCAGG + Intronic
995134605 5:108667322-108667344 CACATGTAGGAGAATGAAACTGG - Intergenic
995293348 5:110486513-110486535 CACATGTAGGAGAATGAAACTGG - Intronic
995472604 5:112518825-112518847 CACATGTAGGAGAATGAAACTGG - Intergenic
995723037 5:115156611-115156633 CACATGTAGGAGAATGAAACTGG + Intronic
996025717 5:118643457-118643479 CACATGTAGGAGAATGAAACTGG + Intergenic
996032358 5:118720164-118720186 CACATGTAGGAGAATGAAACTGG + Intergenic
996123645 5:119700554-119700576 CACATGTAGGAGAATGAAACTGG - Intergenic
996517481 5:124388367-124388389 CACATGTAGGAGAATGAAACTGG - Intergenic
996561674 5:124836561-124836583 CACATGTAGGAGAATGAAACTGG + Intergenic
997761261 5:136450281-136450303 CACATGTAGGAGAATGAAACTGG + Intergenic
997765110 5:136495258-136495280 CACATGTAGGAGAATGAAACTGG - Intergenic
997922970 5:138000149-138000171 CACTTTAAGGAGACTAAGGCTGG + Intronic
997954462 5:138267933-138267955 CACATGTAGGAGAATGAAACTGG + Intronic
999599481 5:153245795-153245817 CACATGTAGGAGAATGAAACTGG - Intergenic
999677539 5:154019826-154019848 CACATGTAGGAGAATGAAACTGG + Intronic
1000511218 5:162185693-162185715 CACATGTAGGAGAATGAAACTGG - Intergenic
1000584812 5:163084368-163084390 CACATGCAGGAGAATGAAACTGG + Intergenic
1000780165 5:165470287-165470309 CACATGTAGGAGAATGAAACTGG + Intergenic
1001189374 5:169613638-169613660 CACATGTAGGAGAATGAAACTGG + Intergenic
1001291144 5:170461908-170461930 CACATGTAGGAGAATGAAACTGG + Intronic
1001458218 5:171884235-171884257 CACATACAGGAGAATGAAACTGG - Intronic
1002956423 6:1869821-1869843 CACATCCAGGAGGAAGAGCCAGG - Intronic
1003029016 6:2584745-2584767 CACATGTAGGAGAATGAAACTGG - Intergenic
1003297074 6:4839615-4839637 CACATGTAGGAGAATGAAACTGG - Intronic
1003495497 6:6659984-6660006 AACATTAGGTAGAAAGAGCCTGG - Intergenic
1003929904 6:10914219-10914241 CACATGTAGGAGAATGAAACTGG - Intronic
1004504228 6:16234694-16234716 CACATGTAGGAGAATGAAACTGG - Intergenic
1005760846 6:28966653-28966675 CACATGTAGGAGAATGAAACTGG + Intergenic
1005792787 6:29323453-29323475 CACATATAGGAGAATGAAACTGG - Intergenic
1005877780 6:30026821-30026843 CACATGTAGGAGAATGAAACTGG + Intergenic
1006199372 6:32273447-32273469 CACATGTAGGAGAATGAAACTGG + Intergenic
1006287799 6:33111144-33111166 CACATGTAGGAGAATGAAACCGG - Intergenic
1006475805 6:34252641-34252663 CACATGTAGGAGAATGAAACTGG + Intergenic
1006722484 6:36166063-36166085 CACATGTAGGAGAATGAAACTGG + Intergenic
1006978844 6:38129519-38129541 CACATGTAGGAGAATGAAACTGG - Intronic
1007823242 6:44577747-44577769 CACATTAAGGAAAAATGGCCTGG + Intergenic
1007891967 6:45303063-45303085 CACATAAAGGAGAGTGAAACTGG + Intronic
1007906645 6:45467927-45467949 AACTTTAAGGAGAAAGAGGCTGG - Intronic
1008023556 6:46607987-46608009 CACATGAAGGAGAATGAACTTGG + Intronic
1008115916 6:47550004-47550026 CACATGCAGGAGAATGAAACTGG + Intronic
1008190610 6:48452437-48452459 CACATATAGGAGAATGAAACTGG + Intergenic
1008313176 6:50003876-50003898 CACATGTAGGAGAATGAAACCGG + Intergenic
1008409361 6:51155316-51155338 CACATGTAGGAGAATGAAACTGG - Intergenic
1008416117 6:51242630-51242652 CACATGTAGGAGAATGAAACTGG - Intergenic
1009495293 6:64338928-64338950 CACATATAGGAGAATGAAACTGG + Intronic
1010045752 6:71441290-71441312 CACATGTAGGAGAATGAAACTGG + Intergenic
1010164694 6:72901544-72901566 CACATTTAGGAGAATGAAATTGG - Intronic
1010344406 6:74794735-74794757 CACATGTAGGAGAATGAAACTGG + Intergenic
1010675223 6:78735698-78735720 CATATTCAGAAGAATGAGACTGG - Intergenic
1011225578 6:85101929-85101951 CACATGTAGGAGAATGAAACTGG + Intergenic
1011327540 6:86166342-86166364 CACATGTAGGAGAATGAAACTGG + Intergenic
1011328672 6:86179363-86179385 CACATGTAGGAGAATGAAACTGG - Intergenic
1011510034 6:88090010-88090032 CAGACTAAGGAGAATGTGCAGGG + Intergenic
1011514795 6:88142032-88142054 GCCATTAAGGAGCATGAGACCGG + Exonic
1011789325 6:90881002-90881024 CACATACAGGAGAATGAAACTGG - Intergenic
1011892908 6:92189597-92189619 CACATGTAGGAGAATGAAACTGG - Intergenic
1012183308 6:96182635-96182657 CACATGTAGGAGAATGAAACTGG - Intronic
1012634319 6:101516532-101516554 CACATGTAGGAGAATGAAACTGG + Intronic
1012738230 6:102978284-102978306 CACATGTAGGAGAATGAAACTGG + Intergenic
1012923153 6:105240524-105240546 CACATGTAGGAGAATGAAACTGG + Intergenic
1013332188 6:109114556-109114578 CATATTAAGGGAAATAAGCCAGG + Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1014060949 6:117071227-117071249 CACATTTAGAAGAATGAAACTGG - Intergenic
1014592033 6:123285481-123285503 CACATGTAGGAGAATGAAACTGG + Intronic
1014604298 6:123453046-123453068 CACATGTAGGAGAATGAAACTGG + Intronic
1015033374 6:128623723-128623745 CACATGTAGGAGAATGAAACTGG + Intergenic
1015222551 6:130821213-130821235 CACATGTAGGAGAATGAAACTGG + Intergenic
1015565969 6:134571804-134571826 CACATGTAGGAGAATGAAACTGG + Intergenic
1015877550 6:137838532-137838554 CACATGTAGGAGAATGAAACTGG - Intergenic
1015914351 6:138200619-138200641 CACATGTAGGAGAATGAAACTGG + Intronic
1016289564 6:142513790-142513812 CACATGTAGGAGAATGAAACTGG - Intergenic
1018010060 6:159661377-159661399 CACATGAAGGAGAATGAAACTGG + Intergenic
1021204701 7:17766320-17766342 CACATGTAGGAGAATGAAACTGG + Intergenic
1021766493 7:23954999-23955021 CACATGCAGGAGAATGAATCTGG + Intergenic
1021778489 7:24077876-24077898 CACATGTAGGAGAATGAAACTGG - Intergenic
1022295763 7:29051046-29051068 CACATGCAGGAGAATGAAACTGG + Intronic
1022550134 7:31230432-31230454 CACATGTAGGAGAATGAAACTGG - Intergenic
1023355721 7:39365333-39365355 CACATGCAGGAGAATGAAACTGG + Intronic
1023527554 7:41120590-41120612 CACATGTAGGAGAATGAAACTGG - Intergenic
1023544387 7:41302408-41302430 CACATGTAGGAGAATGAGACTGG + Intergenic
1024126829 7:46307165-46307187 CACATATAGGAGAATGAAACTGG + Intergenic
1024493251 7:50011158-50011180 CACATGTAGGAGAATGAAACTGG + Intronic
1024536825 7:50442028-50442050 AACACTAAGCAGAATGAGCTAGG + Intergenic
1024916824 7:54510785-54510807 CACATGTAGGAGAATGACACTGG - Intergenic
1027650580 7:80862887-80862909 CACATGGAGGAGAATGAAACTGG + Intronic
1027699629 7:81453704-81453726 CACATGTAGGAGAATGAAACTGG + Intergenic
1027984462 7:85269254-85269276 CACATGAAGAAGAATGAAACTGG + Intergenic
1028182621 7:87744008-87744030 CACATGAAGGAGAATGAAATTGG - Intronic
1028506419 7:91575854-91575876 CACATATAGGAGAATGAAACTGG - Intergenic
1028747334 7:94342591-94342613 TACACTAAGGTGAATTAGCCAGG + Intergenic
1028961816 7:96757347-96757369 CACATGTAGGAGAATGAAACTGG - Intergenic
1029787201 7:102804477-102804499 CACATGTAGGAGAATGAAACTGG + Intronic
1029820860 7:103145580-103145602 CACATTAAAGAGATTGGACCAGG + Intronic
1030326160 7:108220642-108220664 CACATGTAGGAGAATGAAACTGG + Intronic
1030425779 7:109375437-109375459 CACATGTAGGAGAATGAAACTGG + Intergenic
1031148197 7:118021057-118021079 CACATGTAGGAGAATGAAACTGG + Intergenic
1031740387 7:125422311-125422333 CACATGCAGGAGAATGAAACTGG + Intergenic
1031879625 7:127181788-127181810 CACATGGAGGAGAATGAAACTGG + Intronic
1032667360 7:134049971-134049993 ACCATTAAGAAGAATGAGGCAGG + Intronic
1033260111 7:139836609-139836631 CACATGTAGGAGAATGAAACTGG + Intronic
1033623336 7:143082835-143082857 CACATGTAGGAGAATGAAACTGG + Intergenic
1033798039 7:144870815-144870837 GACATTCAAGAGTATGAGCCTGG + Intergenic
1033898391 7:146104175-146104197 TATATTAAGAAGAATAAGCCAGG - Intergenic
1034705103 7:153135052-153135074 CACATGTAGGAGAATGAAACTGG - Intergenic
1035151668 7:156878989-156879011 CACATGTAGGAGAATGAAACTGG + Intronic
1036028577 8:4939518-4939540 CACATTAAATGAAATGAGCCAGG + Intronic
1036043507 8:5113476-5113498 CACATTAAGGAAAAAGTGACAGG + Intergenic
1036287381 8:7455836-7455858 CACATTAAGTAAAATAAGCTAGG + Intronic
1036334099 8:7855689-7855711 CACATTAAGTAAAATAAGCTAGG - Intronic
1036498259 8:9289818-9289840 CACATGTAGGAGAATGAAACTGG - Intergenic
1036634150 8:10537348-10537370 TACATTAAGTAAAATAAGCCAGG + Intronic
1036717312 8:11137952-11137974 GGCATTAGAGAGAATGAGCCTGG - Intronic
1037045170 8:14291057-14291079 GACATTAAGTAAAATAAGCCAGG + Intronic
1037055187 8:14431484-14431506 CACATGTAGGAGAATGAAACTGG + Intronic
1037055401 8:14434164-14434186 CACATGTAGGAGAATGAAACTGG - Intronic
1037135952 8:15460725-15460747 CACATGTAGGAGAATGAAACTGG - Intronic
1039123984 8:34180144-34180166 CACATGTAGGAGAATGAAACTGG + Intergenic
1039668191 8:39560528-39560550 GACATTAAGTAAAATAAGCCAGG - Intergenic
1039728074 8:40243233-40243255 CACATGTAGGAGAATGAAACTGG + Intergenic
1040635268 8:49266015-49266037 CACATGTAGGAGAATGAAACTGG - Intergenic
1040642915 8:49361161-49361183 TACATTAAGCAAAATAAGCCAGG - Intergenic
1041112350 8:54495746-54495768 CACATGAAGGAGAATGAAACTGG - Intergenic
1041364289 8:57084376-57084398 CACATGTAGGAGAATGAAACTGG + Intergenic
1042212660 8:66396908-66396930 CACATGTAGGAGAATGAAACTGG - Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042608369 8:70570237-70570259 CACATGTAGAAGAATGAGACTGG + Intergenic
1043278689 8:78435600-78435622 CACATGTAGGAGAATGAAACTGG - Intergenic
1043448809 8:80345650-80345672 CACATGTAGGAGAATGAAACTGG - Intergenic
1043568422 8:81573145-81573167 CACATGTAGGAGAATGAAACTGG - Intergenic
1043671954 8:82897420-82897442 CACATGTAGGAGAATGAAACTGG - Intergenic
1043816472 8:84808199-84808221 CACATGTAGGAGAATGAAACTGG - Intronic
1043832464 8:85006103-85006125 CACATGTAGGAGAATGAAACTGG + Intergenic
1044465955 8:92505787-92505809 CACATCAAGGAAAATAAGGCTGG + Intergenic
1044903718 8:96976793-96976815 CACATGTAGGAGAATGAAACTGG + Intronic
1044907651 8:97022178-97022200 CACATGTAGGAGAATGAAACTGG + Intronic
1045095350 8:98791760-98791782 CACATGTAGGAGAATGAAACTGG + Intronic
1045121795 8:99045742-99045764 CACATGTAGGAGAATGAAACTGG - Intronic
1046075802 8:109310414-109310436 CACATGTAGGAGAATGAAACAGG + Intronic
1046235745 8:111422155-111422177 CACATGTAGGAGAATGAAACTGG - Intergenic
1046248317 8:111595141-111595163 CCCATGCAGGAGAATGAACCTGG - Intergenic
1046468636 8:114638568-114638590 CAAATTCAAGACAATGAGCCAGG + Intergenic
1046498631 8:115046167-115046189 CACATGTAGGAGAATGAAACTGG + Intergenic
1046782240 8:118228079-118228101 CACATGTAGGAGAATGAAACTGG + Intronic
1046825114 8:118681106-118681128 TACATTAAGTGAAATGAGCCAGG + Intergenic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047271611 8:123365713-123365735 CACATGTAGGAGAATGAAACTGG + Intronic
1047345619 8:124025375-124025397 CACATGTAGAAGAATGAACCTGG - Intronic
1048022344 8:130550888-130550910 TATATTAAGCAAAATGAGCCCGG - Intergenic
1048476054 8:134743191-134743213 TAAATTAAGGAAAATGTGCCAGG + Intergenic
1049561366 8:143313051-143313073 CACATGCAAGAGAATGACCCTGG + Intronic
1049868263 8:144953693-144953715 CACATGTAGGAGAATAATCCTGG - Intergenic
1049897740 9:125743-125765 CACATGTAGGAGAATGAAACTGG - Intronic
1050252948 9:3764838-3764860 CACATTAAAAAGAATGATACAGG - Intergenic
1050635849 9:7611884-7611906 CACATGTAGGAGAATGAAACTGG - Intergenic
1050799686 9:9594469-9594491 CACATGTAGGAGAATGAAACTGG - Intronic
1050856350 9:10361850-10361872 GAGATTAAGGAGAAAGAGCATGG + Intronic
1051277478 9:15410940-15410962 CACATGTAGGAGAATGAAACTGG - Intergenic
1051600972 9:18873495-18873517 CACATGTAGGAGAATGAAACTGG - Intronic
1051976877 9:22961141-22961163 ATTATTTAGGAGAATGAGCCAGG + Intergenic
1052247373 9:26352239-26352261 CACATGTAGGAGAATGAAACTGG + Intergenic
1052253956 9:26431639-26431661 CACATGTAGGAGAATGAAACTGG + Intergenic
1052514228 9:29459611-29459633 CACATGTAGGAGAATGAAACTGG - Intergenic
1052549901 9:29934711-29934733 CACATGTAGGAGAATGAAACTGG - Intergenic
1052624519 9:30957942-30957964 CACATGTAGGAGAATGAAACTGG - Intergenic
1052731074 9:32286762-32286784 CACATGTAGGAGAATGAAACTGG - Intergenic
1052895673 9:33745988-33746010 CACATACAGAAGAATGAACCTGG + Intergenic
1053212081 9:36238927-36238949 CACATGTAGGAGAATGAAACTGG - Intronic
1053740829 9:41136033-41136055 CACATGTAGGAGAATGAAACTGG - Intronic
1054443817 9:65292178-65292200 CACATGTAGGAGAATGAAACTGG - Intergenic
1054486456 9:65729325-65729347 CACATGTAGGAGAATGAAACTGG + Intronic
1054687522 9:68295266-68295288 CACATGTAGGAGAATGAAACTGG + Intronic
1055345921 9:75338764-75338786 CACATGTAGGAGAATGAAACTGG - Intergenic
1056322321 9:85447524-85447546 CACATGTAGGAGAATGAAACTGG - Intergenic
1057690760 9:97282266-97282288 CACATTAAGTGAAATAAGCCAGG - Intergenic
1058085320 9:100742069-100742091 GACATTAAGTGGAATAAGCCAGG - Intergenic
1058156321 9:101519916-101519938 CACATGTAGGAGAATGAAACTGG - Intronic
1058308008 9:103466963-103466985 CACATGTAGGAGAATGAAACTGG - Intergenic
1058367173 9:104222161-104222183 GACATTAAGTAAAATAAGCCAGG + Intergenic
1058540251 9:106004489-106004511 CACATGTAGGAGAATGAAACTGG - Intergenic
1058631115 9:106987859-106987881 CACATGTAGGAGAATGAAACTGG - Intronic
1059021886 9:110584744-110584766 CACATGTAGGAGAATGAAACTGG - Intergenic
1059609187 9:115873790-115873812 CACATACAGGAGAATGAAACTGG - Intergenic
1059815613 9:117909805-117909827 CACATATAGGAGAATGAAACTGG + Intergenic
1059828243 9:118058360-118058382 CCCAATAAGGTGTATGAGCCTGG + Intergenic
1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG + Intergenic
1062603945 9:137334528-137334550 CACATGTAGGAGAATGAAACTGG + Intronic
1185852556 X:3502666-3502688 CACATGCAGGAGAATGAAACTGG + Intergenic
1186238615 X:7542127-7542149 CACATGTAGGAGAATGAAACTGG - Intergenic
1186348887 X:8723004-8723026 CACATGTAGGAGAATGAAACTGG + Intronic
1186454030 X:9697184-9697206 CACATTAAGAAGAAAGAAACTGG - Intronic
1186949152 X:14603484-14603506 CACATGTAGGAGAATGAAACTGG + Intronic
1187218749 X:17303005-17303027 CACATGTAGGAGAATGAAACTGG - Intergenic
1187430643 X:19221320-19221342 CACATGTAGGAGAATGAAACTGG - Intergenic
1187673384 X:21691139-21691161 CACAGTAACTAGATTGAGCCAGG - Intergenic
1187773139 X:22724588-22724610 CACATGTAGGAGAATGAAGCTGG + Intergenic
1187849091 X:23573478-23573500 CACATGTAGGAGAATGAAACTGG + Intergenic
1188040053 X:25361433-25361455 CACATGTAGGAGAATGAAACTGG - Intergenic
1188080864 X:25838753-25838775 CACATGTAGGAGAATGAAACTGG + Intergenic
1188082599 X:25862021-25862043 CACATGTAGGAGAATGAAACTGG - Intergenic
1188794408 X:34443745-34443767 CACATGTAGGAGAATGAAACTGG + Intergenic
1189130911 X:38497043-38497065 CACATGTAGGAGAATGAAACTGG + Intronic
1189232106 X:39460608-39460630 GACAGGAAGGAGAATGAGACTGG - Intergenic
1189604197 X:42659160-42659182 CACATGTAGGAGAATGAAACTGG + Intergenic
1189662865 X:43321728-43321750 CACATGTAGGAGAATGAAACTGG - Intergenic
1189878697 X:45466383-45466405 CACATGTAGGAGAATGAAACTGG - Intergenic
1190895057 X:54609545-54609567 CACATGTAGGAGAATGAAACTGG - Intergenic
1191148580 X:57195798-57195820 CACATGTAGGAGAATGAAACTGG - Intergenic
1191778054 X:64839810-64839832 CACATGTAGGAGAATGAAACTGG - Intergenic
1191891913 X:65952546-65952568 CACATATAGGAGAATGAAACTGG - Intergenic
1191929830 X:66359108-66359130 CATGTTAAGTAAAATGAGCCAGG + Intergenic
1191944873 X:66522378-66522400 CACATGTAGGAGAATGAAACTGG - Intergenic
1191950732 X:66589262-66589284 CACATGTAGGAGAATGAAACTGG - Intergenic
1191997296 X:67109286-67109308 CACATGTAGGAGAATGAAACTGG - Intergenic
1192014071 X:67309835-67309857 CACATGTAGGAGAATGAAACTGG - Intergenic
1192068702 X:67914237-67914259 CACATGTAGGAGAATGAAACTGG - Intergenic
1192091879 X:68167949-68167971 TACGTTAAGGAAAATAAGCCAGG + Intronic
1192298475 X:69875425-69875447 CACATGCAGGAGAATGAAACTGG + Intronic
1192686743 X:73314979-73315001 CACATGTAGGAGAATGAAACTGG - Intergenic
1192879794 X:75271439-75271461 CACATGTAGGAGAATGAAACTGG + Intergenic
1192880697 X:75280467-75280489 CACATGTAGGAGAATGAAACTGG - Intronic
1193017023 X:76746070-76746092 CACATGGAGAAGAATGAACCTGG + Intergenic
1193077343 X:77368736-77368758 CACATGTAGGAGAATGAAACTGG + Intergenic
1193190727 X:78567231-78567253 CACATTTAGAAGAATGATGCTGG - Intergenic
1193197307 X:78648079-78648101 CACATGTAGGAGAATGAAACTGG + Intergenic
1193216584 X:78871395-78871417 CACATGTAGGAGAATGAAACTGG - Intergenic
1193283286 X:79682171-79682193 TACATTAAGTAAAATAAGCCAGG - Intergenic
1193323227 X:80149182-80149204 CACATGTAGGAGAATGAAACTGG - Intergenic
1193366666 X:80642506-80642528 CACATGTAGGAGAATGAAACTGG + Intergenic
1193405343 X:81094144-81094166 CACATGTAGGAGAATGAAACTGG + Intergenic
1193423373 X:81311593-81311615 CACATGTAGGAGAATGAAACTGG - Intergenic
1193451231 X:81670480-81670502 CACATGTAGGAGAATGAAACTGG + Intergenic
1193517684 X:82489748-82489770 CACATGTAGGAGAATGAAACTGG + Intergenic
1193550767 X:82890016-82890038 CACATGTAGGAGAATGAAACTGG + Intergenic
1193578905 X:83237370-83237392 CACATGTAGGAGAATGAAACTGG + Intergenic
1193989611 X:88290103-88290125 CACATGTAGGAGAATAAACCTGG + Intergenic
1194104205 X:89748342-89748364 CACATTTAGGAGAATGAAACTGG - Intergenic
1194527932 X:95002573-95002595 CACATGTAGGAGAATGAAACTGG + Intergenic
1194543074 X:95198988-95199010 CACATGTAGGAGAATGAAACTGG - Intergenic
1194888797 X:99352548-99352570 CATATTAAAGAGAATAATCCAGG - Intergenic
1194956033 X:100181620-100181642 CACATGTAGGAGAATGAAGCTGG + Intergenic
1195015666 X:100777787-100777809 CACATGTAGGAGAATGAAACTGG - Intergenic
1195135308 X:101900498-101900520 CACATGTAGGAGAATGAAACCGG - Intronic
1195556901 X:106237037-106237059 CACATGTAGGAGAATGAAACTGG + Intergenic
1195796173 X:108649702-108649724 CACATGTAGGAGAATGAAACTGG + Intronic
1195818402 X:108914481-108914503 CACATATAGGAGAATGAAACTGG + Intergenic
1195912999 X:109907636-109907658 CACATGTAGGAGAATGAAACTGG - Intergenic
1195972360 X:110487050-110487072 CACATGTAGGAGAATGAAACTGG - Intergenic
1196111218 X:111949132-111949154 CACATGTAGGAGAATGAAACTGG + Intronic
1196179499 X:112674236-112674258 CACATGTAGGAGAATGAAACTGG + Intronic
1196471534 X:116034170-116034192 CACATGTAGGAGAATGAAACTGG + Intergenic
1196590136 X:117477637-117477659 CACATGTAGGAGAATGAAACTGG - Intergenic
1196620011 X:117810728-117810750 CACATATAGGAGAATGAAACTGG + Intergenic
1196753005 X:119134272-119134294 CACAGCAATGTGAATGAGCCTGG - Intronic
1196947832 X:120845469-120845491 CACATGTAGGAGAATGAAACTGG - Intergenic
1197054652 X:122102308-122102330 CACATGTAGGAGAATGAAACTGG + Intergenic
1197100634 X:122649985-122650007 CACATGTAGAAGAATGAACCTGG + Intergenic
1197583638 X:128315905-128315927 CACATGTAGGAGAATGAAACTGG + Intergenic
1197646036 X:129017760-129017782 CACATGTAGGAGAATGAAACTGG - Intergenic
1197664208 X:129205904-129205926 CACCTCTAGGAGAATGAACCTGG - Intergenic
1198452036 X:136776485-136776507 CACATGTAGGAGAATGAACCTGG + Intronic
1198616903 X:138468144-138468166 CACATATAGGAGAATGAAACTGG + Intergenic
1198894633 X:141439370-141439392 CACATATAGGAGAATGAAACTGG - Intergenic
1199007989 X:142724696-142724718 CACATGTAGGAGAATGAAGCTGG + Intergenic
1199206299 X:145152684-145152706 CACATGTAGGAGAATGAAACTGG + Intergenic
1200317700 X:155151018-155151040 CACATGTAGGAGAATGAAACTGG - Intergenic
1200415398 Y:2904678-2904700 CACATGTAGGAGAATGAAACTGG + Intronic
1200456159 Y:3396151-3396173 CACATTTAGGAGAATGAAACTGG - Intergenic
1201761867 Y:17549205-17549227 CACATGTAGGAGAATGAAACTGG - Intergenic
1201839685 Y:18356785-18356807 CACATGTAGGAGAATGAAACTGG + Intergenic