ID: 979835695

View in Genome Browser
Species Human (GRCh38)
Location 4:125364710-125364732
Sequence AGGTTTTTTCAGCTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979835691_979835695 22 Left 979835691 4:125364665-125364687 CCATGAGCTGGAAACGCATACAA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG 0: 1
1: 0
2: 0
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979835695 Original CRISPR AGGTTTTTTCAGCTGGTGCA TGG Intronic
900554748 1:3274754-3274776 AGGTTTATTTTGCTGCTGCATGG + Intronic
902158523 1:14509908-14509930 ATGTTATTTCAGCTTTTGCATGG - Intergenic
902710739 1:18238101-18238123 TGGGTTTTTCAGTTGGGGCATGG - Intronic
904539389 1:31222550-31222572 TTCTTTCTTCAGCTGGTGCAGGG + Intronic
904923286 1:34025745-34025767 AGGTTTTGTCACTTGGTGGATGG - Intronic
905654829 1:39679630-39679652 AGTCTCTCTCAGCTGGTGCAGGG + Exonic
905693047 1:39956463-39956485 AGGTTGTGGCAGCTGGTGCCGGG + Intronic
906851100 1:49251218-49251240 AGGTGTGGGCAGCTGGTGCATGG - Intronic
906955804 1:50372712-50372734 AGGAATTTTCATCTGGAGCATGG + Intergenic
907002702 1:50877944-50877966 AGGTTGTTTCAGCAGCTGCTAGG - Intronic
907830455 1:58060005-58060027 AGGATTTTTCATGTAGTGCAGGG + Intronic
909690984 1:78407848-78407870 AGGTTTTCTCATCTGTAGCAGGG - Intronic
910307508 1:85783136-85783158 AGCTTCTTCCAGGTGGTGCATGG + Intronic
910651924 1:89578027-89578049 AGGTTTTGTCACCTTGGGCAAGG + Intronic
912029600 1:105223157-105223179 AGGTATTTTTAGCTGTTGAATGG - Intergenic
912035287 1:105304840-105304862 AGATTTTTACATCTGTTGCAGGG - Intergenic
912573534 1:110642954-110642976 AGGTTTGTCCAGCTGGGGGAGGG + Intergenic
916165967 1:161967690-161967712 AGGATTTATCATCTGGTACAAGG + Intergenic
919406458 1:197190262-197190284 AGCTGTTTTCAACTAGTGCATGG - Intronic
924261628 1:242237534-242237556 TGCTGTTTTCAACTGGTGCATGG + Intronic
1063241218 10:4171114-4171136 ACATTTTTTCAGCTGGTCAAAGG + Intergenic
1063510080 10:6636226-6636248 AAGTCTTTTCAGGTGGTACAAGG + Intergenic
1064040551 10:11959251-11959273 CGGTTTTTTCAGCTGGAGGTGGG + Exonic
1065538643 10:26739132-26739154 AGGCCTGTGCAGCTGGTGCAGGG - Intronic
1068127312 10:52856332-52856354 ATGATTTTTCTGCTGGTGGAGGG - Intergenic
1068778488 10:60893367-60893389 ATGTTTTTTAAACTGGTGAAAGG - Intronic
1069752986 10:70756720-70756742 AGGTTGTTTCAGCAGCTGCTAGG + Intronic
1072915015 10:99532591-99532613 TGTTTTTTTCAGCTGCTGCGCGG - Intergenic
1073476790 10:103759002-103759024 GGGCTTTCTCAGCTGGTGCCTGG + Intronic
1073716590 10:106114900-106114922 ATGTTTTTCCTGCTGGTGCCAGG + Intergenic
1077250814 11:1559845-1559867 GGGTCCTTCCAGCTGGTGCAGGG - Intronic
1079959628 11:26907054-26907076 TGGTTTTTTCAACTGAGGCAGGG + Intergenic
1080910621 11:36594460-36594482 TGGTTCTTTCAGCTGACGCATGG - Intronic
1085502522 11:77037164-77037186 AGGTTTTTCCAGCTGCGGGAGGG + Intronic
1089986169 11:122816105-122816127 AGGTTTTATCACCTGATTCAGGG + Intergenic
1094166333 12:27447424-27447446 AGGCTGTTGCAGCTGGTCCATGG - Intergenic
1098103173 12:67040657-67040679 AGGTTTCCTCAGCTGGGGAATGG + Intergenic
1099508963 12:83509889-83509911 ATGTTTTTTAACCTGGTGCAGGG - Intergenic
1100523186 12:95396089-95396111 AGGCTTTTTCACATGGTGCCTGG - Intergenic
1104652295 12:130544352-130544374 AGGATTGGTCAGCTGGTCCAGGG + Intronic
1105506495 13:21014610-21014632 AGCTTGTTTCAGTTGCTGCATGG - Intronic
1106418329 13:29564705-29564727 AGGCTTATTCAGCTAGTCCATGG - Intronic
1107109036 13:36675503-36675525 TGTTTTTTTCAGAGGGTGCATGG - Intronic
1108143017 13:47446328-47446350 AATTTTATTCAGCTGGTACATGG + Intergenic
1108436944 13:50410235-50410257 TGGTTATTTCAGCTGCTGCTAGG + Intronic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1111961329 13:94814026-94814048 CGGTTTTGAAAGCTGGTGCACGG - Intergenic
1113708040 13:112446769-112446791 AGGCTTGTTCTGCTGGTCCAAGG + Intergenic
1115180961 14:30625377-30625399 AAATTTTTTAAGCTGGTGCTCGG - Intronic
1116593976 14:46816395-46816417 AGGTTATTTCAGGTAGTGCACGG - Intergenic
1116596408 14:46852672-46852694 AGGTTTTTCCATGTGGTGGATGG - Intronic
1118932108 14:70252519-70252541 AGGTGGTTTCAGATGGTGAAAGG - Intergenic
1120006976 14:79369505-79369527 AGGTTTGATGACCTGGTGCATGG + Intronic
1121403075 14:93698774-93698796 AAGTTTTTTCAGCCTGAGCACGG - Intronic
1121707999 14:96014554-96014576 AGGTTGTTTCAGCAGCTGCTAGG - Intergenic
1122425990 14:101605534-101605556 ATGGTTTTTGAGCAGGTGCAAGG - Intergenic
1123939207 15:25208664-25208686 GGGTTTTTTCAGCCCCTGCAGGG + Intergenic
1124862019 15:33450988-33451010 GGGTTGTTTCAGGTGCTGCAAGG - Intronic
1126390367 15:48142976-48142998 AGGCTTTTTCAGCTGATTCTGGG + Exonic
1126981119 15:54244262-54244284 AGGTTTTGTCAGATGGTTGAAGG + Intronic
1127089858 15:55456662-55456684 ACGGTTTTTCAGCTGTTTCATGG - Intronic
1131291581 15:91111344-91111366 TGGTTCTTTGAGATGGTGCAGGG + Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1133838944 16:9391382-9391404 AGTTTTTTTCGGATGGGGCAGGG + Intergenic
1137018402 16:35398097-35398119 AGTTTTTTTCAGTTGCTTCATGG - Intergenic
1138012432 16:53395046-53395068 AGGTTTTTTAATCAGGTGAAAGG - Intergenic
1139557002 16:67718864-67718886 AGGTTTTTGCATCTGGTAAAAGG + Intronic
1141110564 16:81267747-81267769 AGGTTGCTGCAGCTGCTGCAGGG - Intronic
1141554263 16:84826665-84826687 AGGTATTTTCAGCTGGGCCTTGG + Intronic
1141642582 16:85349838-85349860 AGGTTTGTGCTGCTGGTGAATGG - Intergenic
1141832705 16:86518543-86518565 AGTTTTTCTCAGCTGGTCTAAGG - Intergenic
1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG + Intronic
1144853958 17:18258116-18258138 AGGCTTTCTCAGCCGGTGAAGGG - Intronic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146733774 17:35219103-35219125 AAGTTTCTTCAGTTGTTGCAGGG + Intergenic
1150300868 17:64045923-64045945 AGGTCTTTTCTACTGGTGGAGGG - Intronic
1153821746 18:8837966-8837988 AGGTTGTTTCAGCGGGGGGAGGG + Intergenic
1157733033 18:50021206-50021228 AGGTTTTCACAGCTGTGGCATGG - Intronic
1159061150 18:63515209-63515231 CGGTTTTATCAGTTAGTGCATGG + Intergenic
1159336463 18:67074116-67074138 AGGTGTGTGCAGCTGGTGAATGG - Intergenic
1159962077 18:74563102-74563124 AGGTTATTTCATCAGGTGCCAGG + Intronic
1160211770 18:76886989-76887011 AGGTTTTCTCAGCTGGTCACAGG - Intronic
1160312156 18:77804924-77804946 AGGTTTATTCAAGGGGTGCAAGG - Intergenic
1160551251 18:79694959-79694981 TAGTTTTTTCAGCTGTTCCACGG + Intronic
1161193706 19:2974339-2974361 TGGGTTTTGCAGCTGGTCCATGG - Intergenic
1166322720 19:42028596-42028618 AGGTGCTTACAGCTGGTGCTGGG - Intronic
925075200 2:1010640-1010662 ACTTTTTTTCAGATGGTGCTTGG + Intronic
926964551 2:18395930-18395952 GGCTTTGTGCAGCTGGTGCAGGG + Intergenic
931429765 2:62198863-62198885 GGGCTTTTTCAGCTGATGCAGGG + Intronic
934066098 2:88343364-88343386 AAGTTTCTTCAGCTGCTGGAGGG + Intergenic
934952044 2:98583130-98583152 AGGATCATTCAGCTGGTTCAAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
941252871 2:163187965-163187987 AGGTTGTTTCAGCTGGCTCCTGG - Intergenic
941861661 2:170287957-170287979 CGGTCTTTTCAAATGGTGCAGGG - Intronic
942501863 2:176599612-176599634 AAGTTTCTTCAGCTTGTTCATGG - Intergenic
943686900 2:190827972-190827994 AGGTCTTTACAGATTGTGCAAGG + Intergenic
944081965 2:195798056-195798078 AGGTTTTAGGAGCTGCTGCAAGG + Intronic
945566418 2:211406116-211406138 AGGGTTTTTAAGCAGGGGCATGG - Intronic
1169076496 20:2763063-2763085 AGTTTTTGTCACCTGGTGCCAGG - Intergenic
1171185779 20:23123141-23123163 AGCTTGTTTGAGCTGCTGCAGGG + Intergenic
1173423451 20:42923155-42923177 AGGTTTTTTCTCCAGGTGCAGGG - Intronic
1175737611 20:61398253-61398275 AGATTTCTTCAGCTTATGCACGG + Intronic
1176520638 21:7821622-7821644 AGATGTCTTCAGCTGGTGCTGGG - Intronic
1178654661 21:34451634-34451656 AGATGTCTTCAGCTGGTGCTGGG - Intergenic
1178784412 21:35639429-35639451 TGGTTTTTGGAGCTGGGGCAGGG - Intronic
1182093591 22:27612085-27612107 TGCCTGTTTCAGCTGGTGCATGG - Intergenic
949871010 3:8588928-8588950 TGGTTTTTTCACCTGTTCCATGG - Intergenic
951681872 3:25303443-25303465 AATTTTTTTGAGCTGGTGCAAGG + Intronic
952422171 3:33142259-33142281 AGGTTTTTTCTGCTGGTCTGGGG - Intronic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
952822443 3:37496763-37496785 TGGTATTTTCAGCTGCTGCTAGG + Intronic
956481360 3:69677004-69677026 AAGATTATACAGCTGGTGCAGGG - Intergenic
957471802 3:80668298-80668320 TGGTTTCTTCAGCAGGTCCAGGG + Intergenic
958271708 3:91508240-91508262 AGGTTTTCTTGGCTGGTGCACGG + Intergenic
967193775 3:187008929-187008951 AGGTTGTTTCAGGTTATGCATGG + Intronic
970601214 4:17642249-17642271 AGGTGTTTTCAGGAGGCGCAGGG + Intronic
974097784 4:57383985-57384007 ACCCTGTTTCAGCTGGTGCATGG - Intergenic
974880101 4:67745313-67745335 AGCTCTTTTCAGCTGGTTCCTGG - Intronic
975599240 4:76082188-76082210 AGGTTTTCTCAGCAACTGCAGGG - Exonic
977493893 4:97750136-97750158 AGTTTTTCTTTGCTGGTGCATGG + Intronic
977890361 4:102303181-102303203 AGGTTTACTCAGCTAGTGAATGG - Intronic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
982984269 4:162185490-162185512 AGGTTCTGTCAGCTGGACCATGG + Intergenic
983437197 4:167730961-167730983 TGGTTTTGTCAGCTGGGGCCAGG + Intergenic
986520772 5:8615629-8615651 ACGTTTTCTCAGCTGGGTCATGG - Intergenic
989730305 5:44640958-44640980 AGATATTTCCAGCTGGTGAAGGG - Intergenic
990008353 5:50967684-50967706 AGATTTTTCCAGCAGGTGTAAGG - Intergenic
991583904 5:68183378-68183400 AGCTGTTTTCTGCTGGTGAAGGG - Intergenic
992895926 5:81245174-81245196 AGGCTTTGACAGCTGGGGCAGGG + Intronic
994145723 5:96393133-96393155 AGGTTTGTTCAGCTTTTCCAGGG + Exonic
996501664 5:124223682-124223704 AAGTTTTCTCAGGTGGGGCATGG + Intergenic
997254199 5:132415216-132415238 AGGTTATTTCAGGTGGCGCAGGG + Intronic
998648874 5:144094919-144094941 AGGTTTTTGTATTTGGTGCAGGG - Intergenic
999194556 5:149773353-149773375 TGTTTTGTGCAGCTGGTGCATGG + Intronic
999459551 5:151746245-151746267 AGGTTTGTTCAGCAAGTGCTGGG + Intronic
1000599733 5:163257881-163257903 AGGTTTTAGAAGCTGGTGGAAGG - Intergenic
1000633772 5:163620365-163620387 AAGTTTTTCCAGCTAGTCCATGG - Intergenic
1003304301 6:4912523-4912545 GGTTTTTTTCAGATGGTGAAGGG + Intronic
1004133218 6:12941189-12941211 AACTTTCTTCAGCTGGTGAAAGG + Intronic
1004500991 6:16209951-16209973 AGGTTCTGTGAGCTGGGGCAGGG - Intergenic
1004635705 6:17465666-17465688 AGGTCTTTTCTGCTGGTTCTGGG - Intronic
1006471124 6:34229375-34229397 ATGTGTTTTCAGCTGGTCCTGGG + Intergenic
1007581018 6:42960310-42960332 AGGTATAGTCAGCCGGTGCAGGG - Intergenic
1008983408 6:57512894-57512916 AGGTTTTCTTGGCTGGTGCATGG - Intronic
1009171464 6:60405762-60405784 AGGTTTTCTTGGCTGGTGCACGG - Intergenic
1010022194 6:71173587-71173609 ATGTTTTTTCAACTGCTGAAAGG - Intergenic
1011157652 6:84351022-84351044 ATAATTTTTCTGCTGGTGCACGG + Intergenic
1011926368 6:92650428-92650450 AGGCTTTTTAACCTGTTGCAGGG - Intergenic
1015940273 6:138443470-138443492 AAGTTTTTTCTTCTGCTGCAGGG - Intronic
1018703364 6:166445517-166445539 TGGTTTTTCCAGCTGGGACAGGG - Intronic
1022245503 7:28555038-28555060 AGTTTTGTTCAGCTGGTGGTAGG + Intronic
1025871899 7:65442177-65442199 AGCTTATTTCAGGAGGTGCATGG + Intergenic
1027125724 7:75555444-75555466 AGGTTCTTCAAGCTGGTTCAGGG + Exonic
1028345730 7:89779858-89779880 AGGCTTTTTCAGCTGGAGGGTGG - Intergenic
1028820275 7:95201842-95201864 AGGTTTTCCTGGCTGGTGCAGGG - Intronic
1029699882 7:102239416-102239438 GGGTTTCTTCAGCTGGTGCTGGG - Exonic
1030350785 7:108483641-108483663 AGTTCTTTTCAACTGGTGAATGG - Intronic
1030749626 7:113215519-113215541 AGATTTTTTTAGTTGTTGCAGGG - Intergenic
1031911382 7:127520279-127520301 TGATTTTTGCATCTGGTGCAAGG - Intergenic
1033684181 7:143623754-143623776 TGGTTCTATCAGCTGCTGCAGGG - Intronic
1033687357 7:143702973-143702995 TGGTTCTATCAGCTGCTGCAGGG - Exonic
1033700431 7:143833869-143833891 TGGTTCTATCAGCTGCTGCAGGG + Intergenic
1036194658 8:6703682-6703704 AGATGCTTTCAGCTGGTCCAAGG - Intergenic
1038782434 8:30579746-30579768 AGATTTTATTTGCTGGTGCAAGG + Intronic
1039549116 8:38430392-38430414 GGGTTTGTTCAGCTGTTGCTAGG - Intronic
1039894334 8:41705603-41705625 GGGTGTTTTCAGTTGGTGCGAGG - Intronic
1042207954 8:66347839-66347861 AGGTTTTATGACCTGCTGCAGGG - Intergenic
1044605126 8:94041642-94041664 AGGTTATTCCAAATGGTGCAAGG + Intergenic
1045113596 8:98956801-98956823 AGGTTTCTTCAGGTGGTCAAGGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047556978 8:125942218-125942240 AGGTTTTGTCAGCAGATGAAAGG - Intergenic
1048637017 8:136307923-136307945 AGTTTTTTTCTGCTGGCCCACGG - Intergenic
1051698316 9:19792172-19792194 ATGTTATTTCAGATGGGGCAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054919286 9:70525909-70525931 AGGTTTTATCACCTGGAGCCTGG + Intergenic
1056259359 9:84832685-84832707 ATGTTTTCGCAGCTGGTTCAAGG - Intronic
1056260596 9:84844164-84844186 AGGTCTTTTCAGCTGCAGCATGG + Intronic
1056725245 9:89108694-89108716 ATGTTTTTACAACTGGTGCAGGG - Intronic
1059853492 9:118369069-118369091 AGCTTTCTTCATCTGGTACATGG - Intergenic
1061484670 9:130914288-130914310 TGGCTTTTGCAGCTGGTGCCTGG - Intronic
1195674079 X:107493926-107493948 AGCTTTCTTGAGCTTGTGCATGG - Intergenic
1196087712 X:111703756-111703778 AACATTTTTCAGCTGGTGAATGG - Intronic
1200397046 X:155997282-155997304 AGGTTGCTTTAGCTGGTGGAAGG + Intergenic