ID: 979836147

View in Genome Browser
Species Human (GRCh38)
Location 4:125370311-125370333
Sequence TGGAACTGTCTCTACTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979836147 Original CRISPR TGGAACTGTCTCTACTTTGT AGG (reversed) Intronic
903946301 1:26965932-26965954 TAGACCTCTCTCTCCTTTGTCGG - Intergenic
904087990 1:27923452-27923474 GGGCACTGTCACTTCTTTGTAGG - Intergenic
905915999 1:41684679-41684701 TGCAACAGTATCTACTTTGTAGG + Intronic
908433032 1:64077616-64077638 TGGTGCTGTCTGTCCTTTGTGGG - Intronic
911264073 1:95722768-95722790 TGAAACTGGCTCTACAATGTTGG + Intergenic
911292495 1:96074300-96074322 TAGACCTGTCTATACTTTTTGGG + Intergenic
912952044 1:114126936-114126958 TGGAACTGTCTCCACTGTCTGGG + Intronic
913010572 1:114679090-114679112 TGGAAGTGTGTCTAGTTTATTGG + Intronic
916822749 1:168415643-168415665 AGCAACTGTCTCTACGTGGTGGG - Intergenic
917377321 1:174363565-174363587 TAGAACTTTCAGTACTTTGTTGG + Intronic
919813779 1:201425160-201425182 GGGAAGTGTCTTTGCTTTGTGGG - Intronic
922245622 1:223794224-223794246 AGTAAACGTCTCTACTTTGTTGG - Intronic
1065386355 10:25137428-25137450 AGAGATTGTCTCTACTTTGTGGG + Intergenic
1067156430 10:43784836-43784858 AGGAAATGTCTCTGCTTTCTTGG - Intergenic
1070704420 10:78627366-78627388 TGCAACTGTCTCAACTCTGGGGG + Intergenic
1070980628 10:80643575-80643597 TGGGACTGTCTGAACTTTTTGGG + Intronic
1071414166 10:85425266-85425288 TGGAAGTGTCTCTAGTGGGTAGG + Intergenic
1073190140 10:101645250-101645272 TGGAACAGCCTCTTCTTTTTGGG + Intronic
1073982208 10:109167474-109167496 TTAAACTGTCTCTACTTTAAGGG - Intergenic
1074296470 10:112193775-112193797 TGGAACTGGCTCTAGTTTTTTGG + Intronic
1078156376 11:8803494-8803516 TGGTTCTGTCTCTAATTTGCTGG - Intronic
1078637895 11:13068945-13068967 TGAGACTGTATCTTCTTTGTGGG - Intergenic
1084654594 11:70507778-70507800 TGGAACTGGCTCTTCATTGATGG - Intronic
1085294650 11:75424212-75424234 AGGAACAGTCTCTCCTTTGATGG + Intronic
1086616414 11:88826161-88826183 TTGAACTGTCAATACTCTGTTGG - Intronic
1091742921 12:2972931-2972953 TGGAACAGTCTTTACCTTGATGG - Intronic
1098383666 12:69896196-69896218 TGTTATTGTCTCTATTTTGTAGG - Intronic
1098393742 12:69996530-69996552 TAGAAATGTCTGTACTATGTGGG + Intergenic
1100227049 12:92568785-92568807 TACAACTGTCTCTTCTTTGTTGG - Intergenic
1106399327 13:29413278-29413300 TGGAACTATCTCATCTTTGAAGG + Intronic
1108882775 13:55141691-55141713 TGGTACTAGCTCTGCTTTGTAGG + Intergenic
1110040006 13:70742613-70742635 TGCCACTTTATCTACTTTGTTGG + Intergenic
1110450322 13:75633354-75633376 TGGCACTATCTCTAGTCTGTGGG - Intronic
1111733267 13:92103598-92103620 TGGAAATTTCTCTAGTTTCTAGG - Intronic
1113895435 13:113761166-113761188 TGGAACTCACTCTTCTTTTTGGG + Intronic
1116148957 14:41113035-41113057 TGGATCTTGGTCTACTTTGTGGG - Intergenic
1116282355 14:42925472-42925494 TGGATCTTTTTTTACTTTGTCGG + Intergenic
1120482520 14:85069830-85069852 TGGAACTTTCAGTACTATGTTGG + Intergenic
1120856217 14:89214688-89214710 TGGAAGTGGCTCGACTTTGAGGG + Intronic
1121118217 14:91358325-91358347 TGGAAATGTCTCTAATGTTTAGG + Intronic
1122862950 14:104590720-104590742 TCTAACTGTCTGTAATTTGTGGG - Intronic
1124629850 15:31329908-31329930 TGGAACTGTGTGTACTAGGTCGG - Intronic
1124923605 15:34049083-34049105 TGAATCTGTCTCATCTTTGTGGG - Intronic
1126318665 15:47398315-47398337 TGGCTCTGTCTCTGCTTTATTGG + Intronic
1127575908 15:60292041-60292063 TGGAGCTATCTCTTCTTAGTTGG - Intergenic
1129666835 15:77584090-77584112 TGCTATTGTCTCTATTTTGTAGG + Intergenic
1132234144 15:100206568-100206590 TGGAAATGTCTCCCCTTTGCTGG + Intronic
1132303144 15:100788778-100788800 TGGCTCTGTCTTTACTGTGTGGG + Intergenic
1133599323 16:7323658-7323680 TGGAACAGACTCTACTTCATAGG + Intronic
1135940485 16:26817703-26817725 AGGAACTGGCTGTGCTTTGTGGG - Intergenic
1135967813 16:27050540-27050562 GGGAATAGTCTCTACTTTGGGGG + Intergenic
1141431472 16:83972373-83972395 TGGAGCTGTCCCTACTAAGTAGG - Intronic
1141947249 16:87319102-87319124 TGGAATTGTCTGTACATTCTGGG - Intronic
1144400235 17:14890333-14890355 TGAAAATCTCTCTACTCTGTAGG + Intergenic
1148076898 17:44942384-44942406 TGGACCTGTCTCTACTAGGGTGG - Intronic
1149190783 17:54058903-54058925 TGGGATTGCCTCTACTTTGATGG + Intergenic
1154337339 18:13476157-13476179 TGGAAGGGGCTCTGCTTTGTGGG + Intronic
1155498158 18:26462712-26462734 TGGGACTGACTCTGCTTTGCAGG - Intronic
1156740154 18:40316290-40316312 TGGTACTCTCTCTGTTTTGTGGG - Intergenic
1158029359 18:52944293-52944315 AGGGATTGTCTATACTTTGTAGG + Intronic
1158524921 18:58204358-58204380 TAGATCTGTCTGTACCTTGTAGG + Intronic
1160201153 18:76796412-76796434 TGGAACTGTGTCCACTTTCTTGG + Intronic
1164476355 19:28578797-28578819 TCCAAGTGTCTATACTTTGTGGG - Intergenic
1167409497 19:49336732-49336754 TGAAACTTTCTCTTCTTTCTGGG - Intronic
1167494389 19:49809196-49809218 TGGAGCTGTGTCTACTCTGCGGG - Exonic
926458118 2:13094076-13094098 TGGAATTGTGCCTACTGTGTTGG - Intergenic
932736690 2:74259469-74259491 TGGAACTCCCACTCCTTTGTAGG + Intronic
933340330 2:81017614-81017636 TGTTACTATCACTACTTTGTAGG - Intergenic
933525724 2:83436128-83436150 TTGGACTTTCTCAACTTTGTAGG - Intergenic
934818235 2:97348731-97348753 TGAAACTCTCTCAACCTTGTGGG + Intergenic
939618687 2:144391071-144391093 TGGGATTGGATCTACTTTGTTGG - Intronic
940642340 2:156359164-156359186 TGGAGCTATTTCTACTTTATGGG - Intergenic
941118642 2:161502707-161502729 TGGTAAAGTCTCTACTTTTTGGG + Intronic
941151672 2:161921590-161921612 TGGAACAGTGTCTAATTTCTAGG + Intronic
942247456 2:174020836-174020858 TGGAACGGTAGATACTTTGTAGG - Intergenic
947134953 2:226968132-226968154 TGGTACTGTAACTTCTTTGTAGG - Intronic
947483033 2:230520745-230520767 TGGAACACTCTCAACTTTGTTGG - Intronic
947914681 2:233823534-233823556 TGGCACTGTCTCTCCTCTGCAGG + Exonic
1168938015 20:1684895-1684917 AAGAACTGTGTCTACCTTGTAGG + Intergenic
1174093609 20:48069666-48069688 TGGAAATGTCAGTACTTTATAGG + Intergenic
1175056953 20:56207608-56207630 TGGAAATGTCTCTTCCTTCTGGG + Intergenic
1177106727 21:16966252-16966274 AGGAACTGTCTGTATTTTCTTGG + Intergenic
1180589661 22:16926346-16926368 TGAAACTCTCTCAACCTTGTTGG - Intergenic
1182481372 22:30611133-30611155 TGGGCCTGTCACCACTTTGTGGG + Intronic
1182983038 22:34690070-34690092 TGGAACTGTCACTCGTTGGTAGG + Intergenic
1184062818 22:42094689-42094711 TAGAACTTTCTATACTTTGCTGG + Intergenic
949244123 3:1905398-1905420 TGGAACTATGTATCCTTTGTTGG + Intergenic
952278998 3:31904852-31904874 TGGAACTTTCCCAACTTTCTGGG + Intronic
953119336 3:40024530-40024552 TGGAATTGTGTCTCCTCTGTAGG + Intronic
955767541 3:62360546-62360568 AGGAACTATGTCTGCTTTGTTGG - Intergenic
956374636 3:68601237-68601259 AGGAATTGTCTCTTCTTTCTGGG + Intergenic
956713383 3:72057732-72057754 AGGAACAGTCTCTCCTTTTTAGG - Intergenic
959363350 3:105424138-105424160 AGAAATTGTATCTACTTTGTAGG + Intronic
959895798 3:111604386-111604408 GGAAACTGTCTCTCCTTTTTAGG + Intronic
962412625 3:135154472-135154494 TGGAAGTTTCTCTCCTTAGTTGG - Intronic
964746946 3:160021283-160021305 TGGAACTGCCTGCACTTTCTGGG - Intronic
967302505 3:188029285-188029307 TTGAGCTGTTTCCACTTTGTAGG - Intergenic
971077866 4:23170991-23171013 GGGAAATGCCTCTGCTTTGTAGG - Intergenic
976147033 4:82052029-82052051 GGGAACTGTCTCTCCTTTTCAGG - Intergenic
976527961 4:86115461-86115483 TGGAACTGCTTCTATTTTTTTGG + Intronic
977911782 4:102545622-102545644 AGGATCTGTTTCTACTTTGCAGG + Intronic
977992209 4:103457840-103457862 TGAAAATGTTTCTACTATGTTGG + Intergenic
979836147 4:125370311-125370333 TGGAACTGTCTCTACTTTGTAGG - Intronic
981045411 4:140260339-140260361 TGGAACTGTCATTTCTTTGCTGG - Intronic
981364015 4:143880261-143880283 AGGAATTGTGTCTACTTAGTAGG + Intronic
981385073 4:144120341-144120363 AGGAATTGTGTCTACTTAGTAGG + Intronic
984209468 4:176827976-176827998 TGAAATTGTCTCTATTTTTTTGG - Intergenic
985811315 5:2089939-2089961 TGGAATAGGCACTACTTTGTTGG - Intergenic
988395457 5:30692342-30692364 TGGAACACTCTCTCCTTTATAGG + Intergenic
991172899 5:63648952-63648974 TGGAAGTGGCTGTGCTTTGTAGG - Intergenic
991380959 5:66026342-66026364 TGGAAGTGTCTCAAGTTTATTGG - Exonic
993625216 5:90215902-90215924 TGGAACTTTCAGTACTATGTTGG - Intergenic
993731433 5:91427664-91427686 TACAACTATCTCTACTTTATAGG - Intergenic
994507369 5:100659134-100659156 TGGACCTGTGACTTCTTTGTAGG - Intergenic
996438996 5:123468248-123468270 TGGAACTGTTTCCACTGTGATGG - Intergenic
997435631 5:133872704-133872726 TGGATCTTTCTCTTCTTTGGGGG - Intergenic
1001434969 5:171693180-171693202 AGTAACTGTCTCTACTTCGTAGG + Intergenic
1005289792 6:24368468-24368490 TTGAATTGTCTTTTCTTTGTGGG - Intergenic
1005799297 6:29404011-29404033 TGGAACTTTCACTATTTTGATGG + Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1007299059 6:40852600-40852622 GGGAACTGTCTCTAACATGTGGG + Intergenic
1007530313 6:42536172-42536194 TGGCACTGCCTCTTCTTTGGTGG - Intergenic
1013712787 6:112920604-112920626 TGGAGCTATCTGTACCTTGTAGG - Intergenic
1013746377 6:113351213-113351235 TGGAAAAATCTTTACTTTGTGGG + Intergenic
1014258696 6:119190411-119190433 TGACACTATCTCTAATTTGTGGG + Intronic
1016477927 6:144448723-144448745 TGGATCTGTCTCTTCTTTGGGGG - Exonic
1017525559 6:155238822-155238844 AGGAACTGTTTCTACTTCTTTGG + Intronic
1021325250 7:19258461-19258483 TGGTACCAGCTCTACTTTGTAGG - Intergenic
1024364809 7:48508656-48508678 TGGAGCTGTCTTTATTTTGTAGG + Intronic
1026594205 7:71720693-71720715 TGAAATTTTATCTACTTTGTTGG - Intergenic
1027549811 7:79576486-79576508 TGGAACTCTCTATACTTTCAAGG + Intergenic
1027743126 7:82037631-82037653 TGGAACTTTCTGTACATTTTAGG + Intronic
1028769617 7:94602819-94602841 TGGAATTGTCTCTTGTTTCTTGG + Intronic
1031370803 7:120963613-120963635 TATTACTGTCTCTACTTTATAGG - Intronic
1033690946 7:143736520-143736542 TTGAAATGTCTCCAGTTTGTTGG - Intergenic
1033862659 7:145646512-145646534 TGGAGCTGTCTCGACCTTATGGG + Intergenic
1036100171 8:5773404-5773426 TGAAACTATGTCTACTTTCTAGG + Intergenic
1037193094 8:16151702-16151724 TGGAACTGTCTCTAAAATGATGG - Intronic
1037257047 8:16966660-16966682 AGGAACTGCCTCCACTTTCTGGG + Intergenic
1039614080 8:38940976-38940998 TGTAACTGGCTCTAATTTCTGGG + Intronic
1041056048 8:53987318-53987340 TGTAACTTTCTCTACTCTGCTGG - Intronic
1041411345 8:57559877-57559899 TGGAAATGTGTCTTCTTTGGGGG + Intergenic
1042233453 8:66583378-66583400 TTGAAATGTTTCTACTTTTTTGG - Intronic
1045943144 8:107762863-107762885 GGAAACTGTCTCTTCTTTGAGGG + Intergenic
1046381137 8:113452646-113452668 TGGGACTGTTACTACTTTGGGGG - Intergenic
1046413487 8:113879399-113879421 TGGTATTGTTTCTGCTTTGTGGG - Intergenic
1047835861 8:128689693-128689715 TGGAACTATTTCTACTTCGGAGG - Intergenic
1048936667 8:139363292-139363314 TGTTACTGTCTCCACTTCGTAGG + Intergenic
1049037987 8:140091504-140091526 TGAAAATGTCTCTACTTCCTAGG + Intronic
1052324757 9:27205732-27205754 TGAAAATGTATCTAGTTTGTGGG + Intronic
1052809061 9:33040866-33040888 TGGAACCCTCTGTACTTTGTTGG + Intergenic
1052994174 9:34541165-34541187 TGTATGTGTCTCTGCTTTGTGGG - Intergenic
1054893698 9:70282755-70282777 TGGAAGTGTTGCTACTTTATAGG + Intronic
1059417434 9:114170517-114170539 TGCCACTGTCTCCACATTGTAGG - Intronic
1060674604 9:125501919-125501941 TGGAAGTGTATCGATTTTGTTGG + Intronic
1061836541 9:133333355-133333377 TGGTACTGTCTCCCCTGTGTTGG - Intronic
1186450980 X:9673437-9673459 TGGAGCTGTTTCTACTTCCTAGG - Intronic
1189787050 X:44568518-44568540 TGGATCTGTCTGTTCTTTGAGGG + Intergenic
1193270244 X:79520749-79520771 CAGAACTTTTTCTACTTTGTAGG - Intergenic
1197790566 X:130249697-130249719 TGGTTCTTTCTCTTCTTTGTGGG - Intronic
1198627009 X:138587699-138587721 TGGACCTTTCTCATCTTTGTAGG + Intergenic
1200950010 Y:8888280-8888302 TGAAAATGCCTCTACTTTCTAGG + Intergenic
1201593623 Y:15641769-15641791 GGGAAATTTCTCTACTTTTTAGG + Intergenic
1202044781 Y:20727173-20727195 GGGAACAGTCTCTACTTTCTGGG - Intergenic