ID: 979837360

View in Genome Browser
Species Human (GRCh38)
Location 4:125387742-125387764
Sequence ATGTATATTGATCTGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979837360 Original CRISPR ATGTATATTGATCTGTTGTA TGG (reversed) Intronic
905154965 1:35969494-35969516 ATGTTCATTAATCTGCTGTAAGG + Intronic
905496064 1:38387834-38387856 ATGTATATTTTTCTGTTATTGGG - Intergenic
905722270 1:40215312-40215334 ATGTATATTTAGCTGCTGTTGGG - Intronic
905859266 1:41337470-41337492 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
906552426 1:46676360-46676382 ATGTATAGTTATCTGATGCAAGG + Exonic
906772198 1:48495088-48495110 AAGTATATTGATATATTGAAGGG + Intergenic
908208530 1:61876082-61876104 TTGTATAGTAATATGTTGTAAGG + Intronic
909312313 1:74168046-74168068 ATGTATATTTTGCTGTTGTTGGG + Intronic
909689582 1:78392119-78392141 ATATTTATTGATCTTTTGAATGG + Intronic
910451025 1:87345212-87345234 TTGTATATTTAAGTGTTGTAAGG + Exonic
910738475 1:90489131-90489153 ATGTATATTGCTCTGGTGGTGGG - Intergenic
911764253 1:101655251-101655273 ATGTGTATTGTTCTTTTGTTGGG - Intergenic
911821821 1:102433742-102433764 ATGTTTATTGTGCTATTGTAGGG - Intergenic
911842360 1:102700033-102700055 ATGTATAATGATATTTTGTTTGG - Intergenic
913301981 1:117381094-117381116 AGGTATTTTGCTCTTTTGTATGG + Intronic
913429231 1:118771470-118771492 ATGTATATTCTTCAGTTGTTGGG - Intergenic
913549183 1:119900087-119900109 ATGTATACTGTTCTATAGTATGG + Intergenic
916392746 1:164348789-164348811 ATGTATATTCTGCTGTTGTTGGG - Intergenic
918355572 1:183704357-183704379 ATATATGTTGATCTGTTGTCTGG + Intronic
919618565 1:199837966-199837988 ATGTATATTCTTCTGTTGTTGGG - Intergenic
919681600 1:200441050-200441072 ATGTATATTGATCTATTTCTGGG - Intergenic
919956463 1:202421694-202421716 ATGTTTATTGAATTGTTGAATGG + Intronic
921336778 1:214095063-214095085 ATGTATATTCTTCTGTTGAGTGG - Intergenic
921645782 1:217615724-217615746 AAATATATTAATCTGTTTTATGG - Intronic
921908239 1:220518315-220518337 AGGTATATTAATATTTTGTAAGG + Intergenic
922606599 1:226893546-226893568 AGTTATATTTACCTGTTGTAAGG + Intronic
922630815 1:227108562-227108584 ATGTATATTTTGCTGTTGTTGGG + Intronic
922685648 1:227636934-227636956 ATATATGTTGATCTGTTTTCTGG + Intronic
923477749 1:234351840-234351862 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
923962030 1:239096645-239096667 ATGTATCTTGATTTGTTGTTGGG + Intergenic
924146406 1:241080259-241080281 ATGTATAGTCATTTGTTGTGAGG + Intronic
1063420405 10:5907971-5907993 ATGTATATTTTGCTGTTGTTGGG + Intronic
1065275929 10:24085638-24085660 GTGTGTATTTATCTGTGGTATGG - Intronic
1066510143 10:36086578-36086600 ATGTATAATGAACTTTTGTTAGG + Intergenic
1067827668 10:49590535-49590557 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
1068979414 10:63046033-63046055 ATGTGTATTGTGCTGTTGTTAGG - Intergenic
1070363300 10:75712123-75712145 ATTTCTATTGATGTGTGGTATGG + Intronic
1070687108 10:78494115-78494137 ATGTTTATTTTTCTGTTGTTGGG - Intergenic
1071045770 10:81374550-81374572 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1071224790 10:83516118-83516140 GTGTAGATTATTCTGTTGTAAGG - Intergenic
1071812105 10:89194044-89194066 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1072695207 10:97598348-97598370 CTGTATAGTATTCTGTTGTAAGG - Intronic
1072867146 10:99075488-99075510 ATATATATTCCTCTGTTGTTGGG + Intronic
1073929420 10:108556598-108556620 AAGTGTATTGATCTGTTCTCAGG - Intergenic
1074022550 10:109598529-109598551 ATGTATATTCTTCTGTTTTTAGG - Intergenic
1074913169 10:117930680-117930702 ATTTATATTGGTCTCTTGCAGGG + Intergenic
1075415849 10:122263351-122263373 ATGTATATTGGTCTGCTTGATGG + Intergenic
1075774762 10:124975360-124975382 ATGTATGTTGATATTTTGAAGGG - Intronic
1075839619 10:125489465-125489487 ATATATATCAATCTGTTATAAGG + Intergenic
1079170423 11:18089225-18089247 ATGTACTTTATTCTGTTGTAAGG + Intronic
1079644743 11:22849608-22849630 GTGTATATTGGTCTGTTGATGGG - Intronic
1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG + Intergenic
1080322026 11:31021371-31021393 ATGCATATTATTCCGTTGTATGG - Intronic
1081341243 11:41930253-41930275 ATTTATCTTGACCTGTTGAAAGG - Intergenic
1082110667 11:48270376-48270398 ATGTGTATTTTTCAGTTGTAGGG + Intergenic
1083381869 11:62275767-62275789 ATGTATATTCATCTGTTGTCTGG + Intergenic
1085537824 11:77235508-77235530 ATTTGTATGGATCTATTGTATGG - Intronic
1086830601 11:91558589-91558611 ATCTATAGTGTTCTGTTGCATGG - Intergenic
1087573967 11:99966878-99966900 ATGAATATGTATCTGTGGTAGGG + Intronic
1087907975 11:103721623-103721645 ATGTATATTCAGCTGTTGTTGGG - Intergenic
1088413295 11:109560585-109560607 ATGTATATTGTACAGTTGTTGGG + Intergenic
1089068749 11:115682271-115682293 CTGTATGATGATCTGTGGTATGG + Intergenic
1090942375 11:131398694-131398716 ATGTATAGTGATCGTGTGTAAGG - Intronic
1091166639 11:133482167-133482189 ATCTATATTGATGAGTTGTGTGG - Intronic
1092298337 12:7220576-7220598 ATGTAGATCAATCTTTTGTAAGG + Intergenic
1093176896 12:15922850-15922872 ATGTAGGTTCATCAGTTGTAAGG + Intronic
1093182780 12:15986589-15986611 ATGTAAATTAAACTGTTGTAAGG - Intronic
1093251965 12:16817124-16817146 ATGTATATTCCGCTGTTGTTGGG - Intergenic
1093392915 12:18644462-18644484 TTATATATTATTCTGTTGTAAGG + Intronic
1093897084 12:24585695-24585717 ATGTATATTCTGCTGTTGAATGG - Intergenic
1093936335 12:25004942-25004964 ATGTTTATTGCTCTATTGGAAGG - Intergenic
1094165296 12:27436933-27436955 ATGCATAGTCATCTTTTGTAAGG - Intergenic
1095316814 12:40772653-40772675 ATGAATATTGAGCTGATGTTGGG + Intronic
1098518842 12:71411896-71411918 ATGTATATTTTTCAGTTGTTGGG - Intronic
1098546065 12:71712228-71712250 ATGTATATTCTACTGTTGTTAGG - Intergenic
1098938989 12:76513391-76513413 ATGTATATTCAGTTGTTTTAAGG + Intronic
1099106260 12:78499872-78499894 ATTTATATTGTTTTCTTGTAGGG - Intergenic
1099903302 12:88739466-88739488 TTGGATATTGATTTCTTGTACGG + Intergenic
1100928352 12:99576412-99576434 ATGTATATTCTTGTGTTGTTGGG - Intronic
1101469229 12:104980723-104980745 ATGTATATTCTGCTGTTGCAGGG + Intergenic
1103485106 12:121277521-121277543 CTGTATAGTATTCTGTTGTATGG - Intronic
1104303112 12:127584127-127584149 ATGTATATTTTTCTATTGTTGGG + Intergenic
1104731805 12:131109695-131109717 ATGTATATTCTGCTGTTGGATGG + Intronic
1105757317 13:23479204-23479226 GTTTGTATTGTTCTGTTGTAGGG + Intergenic
1107003471 13:35579248-35579270 ATGTGGATTGATCTGATGAATGG - Intronic
1107207776 13:37815793-37815815 ATGTATATTCTTTTGTTTTAGGG - Intronic
1107557693 13:41532076-41532098 GTGTATATTGGTCTGTTCCATGG - Intergenic
1107797860 13:44072768-44072790 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1107998483 13:45885019-45885041 ATGTACAAGGATCTGTAGTATGG - Intergenic
1108189253 13:47920329-47920351 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108222548 13:48251419-48251441 TTGTATATTTATCTGTTTTCCGG + Intronic
1109981799 13:69917989-69918011 ATTGATATTGATATGTTGTAAGG + Intronic
1110298026 13:73892640-73892662 CTGTATAGTACTCTGTTGTATGG - Intronic
1110389143 13:74953132-74953154 ATGTATATTTTGCTGTTTTAGGG - Intergenic
1110886365 13:80641895-80641917 ACGTATATTTTTCTGTTGGATGG + Intergenic
1111289852 13:86151482-86151504 ATGTATATTGTGCTGTTATGTGG - Intergenic
1111582465 13:90240899-90240921 ATGTGTATTTTGCTGTTGTAGGG - Intergenic
1111842773 13:93471837-93471859 ATGTATATTCTGCTGTTGTTGGG + Intronic
1112060331 13:95733096-95733118 ATGTATATTCTACTGTTTTAGGG + Intronic
1112453358 13:99532946-99532968 ATGTATACTGAACTGATTTAAGG - Intronic
1112953079 13:105026531-105026553 ATGTATATTTATATGTGGGAAGG - Intergenic
1113202691 13:107884720-107884742 ATTCATATTGCCCTGTTGTATGG - Intergenic
1113290796 13:108903514-108903536 ATGTATATGTATTTTTTGTAGGG + Intronic
1113453773 13:110432714-110432736 ATGTAACTCTATCTGTTGTAGGG + Intronic
1113564301 13:111309570-111309592 ATGTATATTGATAGGTTTTTTGG - Intergenic
1114408185 14:22475758-22475780 ATGTATTTTATTCTTTTGTAGGG + Intergenic
1115326570 14:32145923-32145945 ATGTATATTGGTTTTTTGTTTGG + Intronic
1119117610 14:72040728-72040750 GTGTATATTGATCTGCTCAATGG + Intronic
1120586669 14:86320374-86320396 ATGTGTATTAATCTGTTTTCAGG + Intergenic
1122536676 14:102469394-102469416 TTGTATATTGATCTTGTGTCTGG + Intronic
1123805786 15:23871252-23871274 TTGTATGTTAATCTGTTGAAAGG + Intergenic
1124025190 15:25959314-25959336 ATGTATAATGATGTGCTCTAAGG - Intergenic
1125388207 15:39161639-39161661 ATGTATATTCTTCTGCTGTTGGG + Intergenic
1127014714 15:54671014-54671036 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1127573738 15:60270130-60270152 ATGTATATTGTACAGTTGTTGGG + Intergenic
1128298733 15:66549025-66549047 TTGTATGTTGAAATGTTGTATGG + Exonic
1130413385 15:83666670-83666692 ATTTATCTTTATCTGTTGTAGGG - Intronic
1130948002 15:88563551-88563573 CTGGATATTGATCTTTTGTTGGG + Intergenic
1131139648 15:89966771-89966793 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1135392738 16:22107349-22107371 CTGGATAATTATCTGTTGTAGGG - Intronic
1137861570 16:51851819-51851841 ATATATGTAGATCTGCTGTAGGG + Intergenic
1138681648 16:58687954-58687976 CTGAATAATGTTCTGTTGTATGG + Intergenic
1138945032 16:61839139-61839161 ATGCATTTTGATGTGTTTTATGG - Intronic
1141782383 16:86171714-86171736 ATGTATATTGATCTCTCGCATGG - Intergenic
1142913745 17:3116726-3116748 ATGTACTTTCATCTGTTTTATGG + Intergenic
1144380477 17:14691503-14691525 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1150514513 17:65794171-65794193 ATGTATAGTCTTCTGTTGTAGGG + Intronic
1151410433 17:73923067-73923089 ATGTATATTCTTCTATTGTTGGG - Intergenic
1155436894 18:25822079-25822101 ATGTATATTGATCTTGTATCTGG - Intergenic
1156137371 18:34058749-34058771 ATGTATATTCATATTTTTTAAGG - Intronic
1157637917 18:49180047-49180069 TTGTCAAGTGATCTGTTGTATGG + Intronic
1157920333 18:51707576-51707598 ATATATGTTGATCTGTTGTCTGG - Intergenic
1158148149 18:54339177-54339199 GTGTATATTGATGTGTTTAATGG - Intronic
1158795568 18:60841724-60841746 ATGTATATTCAGTTGTTTTAGGG - Intergenic
1160361149 18:78280564-78280586 AGGTTCATTGATCTTTTGTATGG + Intergenic
1163107864 19:15137015-15137037 ATGAATAATATTCTGTTGTATGG + Intergenic
1164237159 19:23347211-23347233 ATATATGTTGATCTGTTGACTGG - Intronic
1164928894 19:32156962-32156984 ATATATATTGATATTTAGTAAGG + Intergenic
1164981525 19:32618221-32618243 ATGTATATTTATCAGTGGAAAGG + Intronic
1165165968 19:33856755-33856777 CTGAATAGTGTTCTGTTGTATGG - Intergenic
1166730463 19:45056476-45056498 ATCTACATTGATGAGTTGTACGG + Exonic
1167299061 19:48668850-48668872 ATATTTATTGAACAGTTGTAGGG - Intronic
925990955 2:9253758-9253780 CTGAATAATGTTCTGTTGTATGG + Intronic
927069730 2:19514921-19514943 ATGTATATTCTTCAGTTGTTTGG + Intergenic
927567569 2:24126339-24126361 ATTTATACTGATTTATTGTATGG + Intronic
928479912 2:31672610-31672632 ATGTATATTCTTCAGTTGTTGGG + Intergenic
928852338 2:35764617-35764639 ATGTATATTTTTCTGTTGTTGGG - Intergenic
928909596 2:36406038-36406060 AATTATATTGATCTCCTGTATGG + Intronic
930294130 2:49531917-49531939 GAGTATATTGATCTGCTTTATGG - Intergenic
930499571 2:52195703-52195725 ATGTATATCTATGTGTGGTAGGG - Intergenic
930625254 2:53689772-53689794 ATGAAGGTTGATCTGTGGTAGGG - Intronic
930678156 2:54226756-54226778 ATAAATGTTGATTTGTTGTAAGG - Intronic
930723621 2:54661597-54661619 ATGAATTTTGATGTGTTTTAAGG - Intronic
930819904 2:55635256-55635278 ATGTGTATTGCTCTAATGTATGG - Exonic
930906732 2:56577726-56577748 ATGTATATTCTTCAGTTGTTAGG - Intergenic
931042031 2:58311596-58311618 TTGAATACTGTTCTGTTGTATGG - Intergenic
931510991 2:62993976-62993998 ATGTATATTAATTTTTTGTGTGG + Exonic
931525811 2:63151640-63151662 ATGTATATTCAACTGTAATATGG + Intronic
932252258 2:70254757-70254779 ATGCATAATGTTCTATTGTATGG + Intergenic
932637617 2:73405984-73406006 ATGTATATTGTGCTGTTGTTGGG + Intronic
933167774 2:79094611-79094633 ATATATGTTGATCTGTTGTCTGG + Intergenic
933289562 2:80423020-80423042 ATGTATAAGGATCTGCAGTACGG + Intronic
933863617 2:86495777-86495799 ATGTATATTTTGCTGTTGTTGGG + Intergenic
934197364 2:89850432-89850454 CTGTTTAATGATCAGTTGTATGG + Intergenic
935550481 2:104447935-104447957 TTGTATATTTCTCTGTTTTAGGG - Intergenic
935847220 2:107179066-107179088 ATGTATAAAGATTTGCTGTAAGG - Intergenic
936340600 2:111628890-111628912 ATGTATATTCTGCTGTTGTTGGG - Intergenic
936439586 2:112539831-112539853 TTGTATATTGATCTTGTGTCTGG - Exonic
936724807 2:115300852-115300874 ATTTATTTTGATCTTTTGAAAGG + Intronic
936990606 2:118360987-118361009 ATGTATATTCTGCTGTTGTTGGG + Intergenic
937467223 2:122145009-122145031 ATATATATTTATCTGTAATATGG + Intergenic
938366105 2:130735863-130735885 ATGTCTATTGATATGTGGTGGGG + Intergenic
940526606 2:154823765-154823787 ATTTATATTGCTTTTTTGTAAGG + Intronic
941829978 2:169945330-169945352 TTCTATATTCATCTGTTGTGTGG - Intronic
941977456 2:171421201-171421223 TTGTATATTGATCTTTTATTTGG - Intronic
942388010 2:175462238-175462260 CTGAATTTAGATCTGTTGTATGG + Intergenic
942585868 2:177476629-177476651 ATGTACATTCTTCTGTTGTTGGG + Intronic
942837609 2:180319221-180319243 ATTTATATTGATCTATTTTCAGG + Intergenic
944027563 2:195189916-195189938 ATGTATATTCTTCAGTTGTTTGG - Intergenic
948451464 2:238076924-238076946 ATGTATATTCTGCTGTTGTTGGG + Intronic
1170050760 20:12142454-12142476 AGGTTTGTTGATCTTTTGTATGG + Intergenic
1173276080 20:41584504-41584526 ATGTATATTCTGCTCTTGTAGGG - Intronic
1178921284 21:36740358-36740380 ATGTCTGTTGATCTGATGGATGG + Intronic
1183145893 22:35991334-35991356 CTGTATATTCCTCTGTTGTCAGG - Intronic
1183846294 22:40543719-40543741 ATTTATTTAGATCTTTTGTAAGG - Intronic
1185211402 22:49572798-49572820 ATGTATATTTATGTATTTTAAGG - Intronic
949431520 3:3981256-3981278 ATGTATATTGCTCTAATGTATGG - Intronic
949601883 3:5608794-5608816 ATGTATCTTGAGCTGTTATTAGG - Intergenic
950070208 3:10146027-10146049 CTGTAAATGGATCTGTTGTGAGG + Intronic
951924579 3:27894452-27894474 ATGTATATTTTGCTGTTGTTTGG - Intergenic
953560795 3:43990940-43990962 ATGTATATTCTGCTGTTGTTGGG - Intergenic
954588496 3:51758760-51758782 ATGTATATTCTTCTGCTGTTGGG + Intergenic
956006545 3:64784702-64784724 CTGAATAATGTTCTGTTGTATGG + Intergenic
956351588 3:68342936-68342958 AAGTATATTTTTCTCTTGTAAGG + Intronic
957668278 3:83265799-83265821 ATGTATATTCTTCTGTTGTTGGG - Intergenic
957918393 3:86716119-86716141 ATGTGTATTGATTTTTGGTATGG + Intergenic
958436082 3:94097339-94097361 ATGTATATTCTTCTGTTACATGG + Intronic
958512663 3:95068431-95068453 ATGTATATTCAGCTGCTGTTGGG - Intergenic
958534253 3:95376978-95377000 AGGTATTTTGATCAATTGTAAGG - Intergenic
958721480 3:97849109-97849131 TGGTTTATTGATCTGTAGTAGGG + Intronic
958818783 3:98948914-98948936 ATGTATATTCTGCTGTTGTTGGG + Intergenic
958929664 3:100195834-100195856 ACGTATATTGAGCTACTGTATGG - Intergenic
960558102 3:119051655-119051677 ATGTATATTGTGCAGTTGTTGGG - Intronic
963751591 3:149185405-149185427 CTGTGTAATGATCAGTTGTAAGG + Exonic
964439694 3:156694632-156694654 ATGTTTATTGAGCTGTGGTCAGG + Intronic
964940408 3:162153681-162153703 AAGTACATTGATCAGTTGTGGGG + Intergenic
965292242 3:166898278-166898300 ATGTATTTTATTCTGTTGTGAGG - Intergenic
965872590 3:173279312-173279334 ATATATGTTGATCTGTTGTCTGG - Intergenic
967857439 3:194129054-194129076 ATATATATGTATATGTTGTATGG + Intergenic
974369791 4:61000703-61000725 GTGTATATTGGTCTGTTTGATGG - Intergenic
974496309 4:62632817-62632839 ATGCATATTGTGCTGTTGTTGGG - Intergenic
974709176 4:65566305-65566327 ATGTGTATAGATATTTTGTAGGG + Intronic
974750348 4:66132231-66132253 AGAAATATTGATATGTTGTATGG - Intergenic
974767857 4:66371341-66371363 ATGTCTACTAATCTGTTTTAAGG - Intergenic
975981595 4:80166778-80166800 ATGTATATTTTGCTGTTGTTTGG + Intergenic
977105794 4:92882608-92882630 ATGTATATTAATGTGATGAAGGG - Intronic
978363485 4:107956139-107956161 ATGTATATTCTTCTGTTGGATGG - Intergenic
978969769 4:114789242-114789264 ATGTATGTTTATCTGTGATAAGG + Intergenic
979029917 4:115630381-115630403 TTTTATATTGATTTGATGTAAGG - Intergenic
979202041 4:117990161-117990183 ATGTATATTCTTCAGTTGTTGGG - Intergenic
979461055 4:120984625-120984647 ATGTATATTCTGCTGTTGTTGGG + Intergenic
979837360 4:125387742-125387764 ATGTATATTGATCTGTTGTATGG - Intronic
980140526 4:128910899-128910921 ATGTATTTTGATATCTGGTAGGG + Intronic
980682541 4:136183023-136183045 ATGTATATTTTTCTATTGTTGGG - Intergenic
981593638 4:146393671-146393693 ATGTATCTTGAACTCTTTTAAGG - Intronic
982119609 4:152129352-152129374 ATGTATATTGTGCTATTGTTGGG + Intergenic
982484367 4:155949924-155949946 ATGGATAGTGATTTGTTGTGGGG - Intronic
982650113 4:158078116-158078138 ATGCATATTTTTCTGTTGTTGGG + Intergenic
983809169 4:172037036-172037058 ATGTATAATCATCTAATGTAGGG - Intronic
988332677 5:29863023-29863045 ATGTATATTCATTTGTTGTTGGG - Intergenic
989185225 5:38617913-38617935 ATGTGTATTCTTCTGTTGTTAGG + Intergenic
989317406 5:40098562-40098584 TTGTATATTAATCTGCTGTTAGG - Intergenic
990114986 5:52379087-52379109 ATGTACATAGATGTGTTGTGGGG + Intergenic
990185447 5:53205342-53205364 ATATATGCTGATCTGTTGTCTGG - Intergenic
990679729 5:58228862-58228884 TTGTGTTTTGATCTGTTGAAGGG - Intergenic
990857287 5:60282977-60282999 ATGTATATTCTGCTGTTGTTGGG + Intronic
992566812 5:78004201-78004223 ATGTATTGTGAGCTGTTGTCAGG - Intronic
994116732 5:96069802-96069824 ATCTATCTTGATTTGTTTTAAGG + Intergenic
996662771 5:126024278-126024300 ATGTAAAGTGATCTGTGTTAAGG + Intergenic
996797127 5:127360082-127360104 GTGTATATTGTGCTGTTGTTGGG + Intronic
999677367 5:154017619-154017641 ATGTATATTCAGCAGTTGTTGGG - Intronic
1000341802 5:160283166-160283188 ATGTGTAATATTCTGTTGTATGG - Intronic
1001797833 5:174516925-174516947 CTGTATAGTATTCTGTTGTATGG + Intergenic
1002299736 5:178250572-178250594 ATGTATATTTAGCTGCTGTTGGG - Intronic
1003301607 6:4889039-4889061 ATGTATATTCTGCTGTTGTTGGG + Intronic
1004050727 6:12076294-12076316 ATGTTTATTGATTTGAAGTAGGG + Intronic
1005382921 6:25255726-25255748 TTTTATCTTGCTCTGTTGTAAGG + Intergenic
1006316409 6:33294487-33294509 ATCTACATTGATCTGTTATAAGG - Intronic
1007439854 6:41849476-41849498 ATGTATATTCTGCTGTTGTTAGG - Intronic
1008712719 6:54247935-54247957 ATGTCAATTGATGTGTTGCAAGG - Intronic
1009332289 6:62438967-62438989 ATGTATATTCATCCCTTGTTGGG + Intergenic
1009747890 6:67843158-67843180 ATGTATATTCTGCTGTTGAATGG - Intergenic
1010565373 6:77405465-77405487 ATGTGTATTCTTCTGTTGGATGG + Intergenic
1010978688 6:82345483-82345505 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1011153923 6:84307580-84307602 ATGTAAATTGTTCTTTTATAAGG - Intergenic
1012593668 6:101015237-101015259 ATGTATATTGCTAAGTTGCATGG + Intergenic
1016108943 6:140197171-140197193 ATAACCATTGATCTGTTGTATGG - Intergenic
1016909910 6:149188277-149188299 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1017454202 6:154585566-154585588 GTGTATATTGGTCTGTTTGATGG + Intergenic
1017621533 6:156304262-156304284 ATGTATATAGATATGTATTATGG - Intergenic
1020464651 7:8463712-8463734 ATTTATATTGCTTTGTTCTATGG + Intronic
1022003605 7:26247621-26247643 ATATATGTTGATCTGTTGTCTGG - Intergenic
1022072454 7:26930701-26930723 ATGTTTATTGCTTTGTTGGAAGG + Intronic
1022544792 7:31175998-31176020 ATGTCTATTGGCCTGTTTTAAGG + Intergenic
1024489989 7:49970446-49970468 AAGTATATTCAGCTGTTGTGTGG - Intronic
1027969816 7:85064707-85064729 ATAAAATTTGATCTGTTGTAAGG + Intronic
1028028466 7:85877060-85877082 ATGTATATTCTGCAGTTGTAGGG - Intergenic
1028843761 7:95456739-95456761 ATGTGTATTCAGCTGTTGTTGGG + Intergenic
1028901837 7:96109847-96109869 ATGTGTATTTTGCTGTTGTAGGG + Intronic
1029029820 7:97455704-97455726 ATGTATATTCATCCATCGTATGG - Intergenic
1030786252 7:113666810-113666832 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
1031471467 7:122173581-122173603 ATGTATATTGATCTGACATAGGG + Intergenic
1033470585 7:141644878-141644900 ATGTATATAGACATGATGTATGG - Intronic
1033637363 7:143224618-143224640 ATGTATATTTCTCTATTCTAGGG - Intergenic
1036542255 8:9728174-9728196 ATTTATTTTGATCTGTGGAATGG + Intronic
1037077956 8:14745363-14745385 ATACATATTGATCTGTTGCCAGG + Intronic
1039181427 8:34871162-34871184 ATGCATACTGATCTGTAGTAAGG - Intergenic
1041363632 8:57077977-57077999 ATGTATATTTATAGGTTTTAGGG - Intergenic
1042158388 8:65867855-65867877 ATATATGTTGATCTGTTGTCCGG - Intergenic
1042767202 8:72336166-72336188 ATGTATATTGGTGTGTTTAAAGG + Intergenic
1043104184 8:76087491-76087513 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1044334612 8:90965532-90965554 ATGTATATTCTGCTGTTGTTGGG - Intronic
1044388442 8:91619399-91619421 TTGTATAATGATGAGTTGTAGGG + Intergenic
1046482284 8:114837849-114837871 ATGTATATTGACTTGCTGTGTGG - Intergenic
1047453049 8:124983962-124983984 ATGTTTAATCATTTGTTGTATGG + Intergenic
1048250248 8:132860029-132860051 ATGTATTCTGCTCTGTTGGATGG + Intergenic
1050498918 9:6273500-6273522 ATGTATATTCTGCTGTTGTTAGG - Intergenic
1051947617 9:22589849-22589871 ATGTCTACTGATCTGATTTAAGG + Intergenic
1052128898 9:24816060-24816082 CTGTTTATAGATCTGTTGTGAGG + Intergenic
1052872558 9:33523040-33523062 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1055181928 9:73399196-73399218 ATGTATATTGTGCAGTTGTTGGG + Intergenic
1055188518 9:73488095-73488117 ATTTATCTTGATCTGTTCAATGG - Intergenic
1056345222 9:85687396-85687418 ATGTATATTCTGCTGTTGTTGGG - Intronic
1056592208 9:87972902-87972924 ATGTGTTTTGATCTGTTAAATGG - Intronic
1056669370 9:88611445-88611467 ATGTGTATTCACCTGTTGTTGGG + Intergenic
1056828599 9:89894616-89894638 ATGTGTAGTGATATTTTGTAAGG + Intergenic
1056879273 9:90374944-90374966 ATGTATATTGTGCTGTTGGTGGG - Intergenic
1058114887 9:101073859-101073881 ATCTATATGAATCTGTTTTATGG + Intronic
1058913567 9:109543507-109543529 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1186342416 X:8658520-8658542 ATGAATATCTATCTGTTGGATGG + Intronic
1186679060 X:11852930-11852952 ATGTATATTCTTCTGTTTGAGGG - Intergenic
1188186675 X:27124981-27125003 CTGGATAATTATCTGTTGTAGGG + Intergenic
1188371575 X:29376014-29376036 AGTTTTATTGATCTGTTGAATGG + Intronic
1188812637 X:34670531-34670553 ATGTATCATGATCTCATGTAAGG + Intergenic
1188990693 X:36816243-36816265 ATGTACATTGTGCTGTTGTTGGG - Intergenic
1189435085 X:40985548-40985570 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1190469179 X:50760022-50760044 ATGTATATTCTTCTGTGGTTGGG + Intronic
1190824749 X:54007239-54007261 ATTTATATTGATTTTGTGTATGG - Intronic
1191021989 X:55871188-55871210 ATGTATATTCTTCTGCTGTTGGG - Intergenic
1191067478 X:56365889-56365911 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1191151303 X:57223016-57223038 ATATATGTTGATTTGTTGTCTGG - Intergenic
1191162838 X:57351016-57351038 ATGTATATTCTTCAGTTGTCAGG - Intronic
1191642269 X:63439317-63439339 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1192778993 X:74275204-74275226 CTGTATTATGATCTGGTGTAAGG + Intergenic
1192826880 X:74706159-74706181 ATATGTATTGTTCTGTTGTCGGG + Intergenic
1192920356 X:75699564-75699586 ATGTATATTCTACTGTTGTTCGG - Intergenic
1193255585 X:79344867-79344889 ATGTATATTGTGTTGTTGTTGGG - Intergenic
1194244265 X:91492649-91492671 ATGTATGTAGATTTGTTATATGG + Intergenic
1194356690 X:92894450-92894472 CTCTTTATTGATCTCTTGTAAGG + Intergenic
1196174097 X:112621391-112621413 CTGTTTATTCATCTGTAGTAGGG - Intergenic
1196916897 X:120546275-120546297 ATGTATACTGCTCTGGTGAAGGG + Intronic
1196994467 X:121366394-121366416 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1197021390 X:121693785-121693807 ATGTATACTTATATGTTGTTGGG + Intergenic
1197078538 X:122382733-122382755 ATATATATTAATTTATTGTATGG - Intergenic
1197109156 X:122752312-122752334 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1197640528 X:128962130-128962152 ATGTGTATTCTTCTGTTGTTGGG - Intergenic
1199242017 X:145557930-145557952 ATGTACATTCTTCTGTTGTTGGG - Intergenic
1199658907 X:150026837-150026859 ATGTATATTCTGCTGTTGTGAGG - Intergenic
1200563246 Y:4733947-4733969 ATGTATGTAGATTTGTTATATGG + Intergenic
1200665022 Y:6011450-6011472 CTCTTTATTGATCTCTTGTAAGG + Intergenic
1200893121 Y:8344605-8344627 ATGTATTTTGATTTATTGCATGG + Intergenic
1202578136 Y:26349482-26349504 ATGTTTATTGAATTGTTGAATGG - Intergenic