ID: 979841241

View in Genome Browser
Species Human (GRCh38)
Location 4:125443393-125443415
Sequence CTGAGGGAATGTAGTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979841241_979841244 4 Left 979841241 4:125443393-125443415 CCGTCTTCACTACATTCCCTCAG 0: 1
1: 0
2: 3
3: 23
4: 256
Right 979841244 4:125443420-125443442 GTTTTACCTTCCTTCTACTGTGG 0: 1
1: 0
2: 1
3: 15
4: 201
979841241_979841246 12 Left 979841241 4:125443393-125443415 CCGTCTTCACTACATTCCCTCAG 0: 1
1: 0
2: 3
3: 23
4: 256
Right 979841246 4:125443428-125443450 TTCCTTCTACTGTGGAATAATGG No data
979841241_979841247 13 Left 979841241 4:125443393-125443415 CCGTCTTCACTACATTCCCTCAG 0: 1
1: 0
2: 3
3: 23
4: 256
Right 979841247 4:125443429-125443451 TCCTTCTACTGTGGAATAATGGG 0: 1
1: 0
2: 0
3: 8
4: 144
979841241_979841249 25 Left 979841241 4:125443393-125443415 CCGTCTTCACTACATTCCCTCAG 0: 1
1: 0
2: 3
3: 23
4: 256
Right 979841249 4:125443441-125443463 GGAATAATGGGAAAAGTGCATGG 0: 1
1: 0
2: 5
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979841241 Original CRISPR CTGAGGGAATGTAGTGAAGA CGG (reversed) Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
903434706 1:23338542-23338564 CTCAGGGAATTTAATGAAGAAGG - Exonic
905364006 1:37439025-37439047 CTCAGAGAAGGTGGTGAAGAGGG - Intergenic
907948615 1:59158941-59158963 CTTAGGGATTGGAGTGAAAAGGG + Intergenic
911524135 1:98964060-98964082 CTTTGGGAATCTAGTGAAAATGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913567780 1:120090486-120090508 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914229363 1:145751224-145751246 CTGAGGGAATTTCTAGAAGATGG - Intronic
914288528 1:146251195-146251217 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914549563 1:148701939-148701961 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914617117 1:149369777-149369799 CTGAGGCAAGGCAGTGGAGATGG + Intergenic
915617557 1:157051117-157051139 CTCAGGGAATTTATTGGAGAAGG + Intergenic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919882999 1:201913057-201913079 CTAAAGGAATGTAGTAAACAAGG + Intronic
920043488 1:203118699-203118721 CTGAGGGAATGGGCTGAAGCCGG + Intronic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
921978207 1:221226249-221226271 CAGAGGGAAGGTAGAGAAGGTGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
924230023 1:241955303-241955325 CTAAGGGAATATAGTGGGGAAGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1065034741 10:21626219-21626241 CTCAGGGAATTTAATAAAGAAGG - Intronic
1066358971 10:34712241-34712263 CTGAGGGAAGGTAGTGAATATGG + Intronic
1066707977 10:38202003-38202025 CAGAGTGAAGGCAGTGAAGAGGG + Intergenic
1067527604 10:47047908-47047930 TGGAGGTGATGTAGTGAAGACGG - Intergenic
1068717650 10:60205913-60205935 TTGATGGAATGTAGTCAAGCAGG - Intronic
1069735420 10:70650785-70650807 CTGAGTGCATGTGGTGAAGCCGG + Intergenic
1070763839 10:79045071-79045093 CTGTGGGAAGGTGGTGAGGAGGG + Intergenic
1070769548 10:79074331-79074353 CTGGGGGAATGAGGTGAAGGAGG + Intronic
1072101223 10:92231267-92231289 CTGATGGCATGTAGTGGAGGGGG - Intronic
1072496368 10:95964241-95964263 CTGAGGGAAACTATTGAAGCAGG - Intronic
1073125743 10:101147747-101147769 TTGAGGGAGTGAAGTGAAGATGG - Intergenic
1073284178 10:102377262-102377284 GTAAGGGAATATTGTGAAGATGG - Intronic
1073808634 10:107127808-107127830 CTGAGAGAATGGAGTGAATGTGG + Intronic
1076082898 10:127599653-127599675 CTGATGGGAAGTAGTGAGGAAGG + Intergenic
1079029731 11:16977558-16977580 CTGAGGGGATATGGAGAAGAGGG - Intronic
1081276916 11:41161508-41161530 CTGTAGGAATCTTGTGAAGATGG - Intronic
1084805460 11:71575889-71575911 CAGAGGGGATGCAGTGCAGACGG + Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1091048094 11:132343430-132343452 CTAAGGAAATGTAGTGAACTAGG - Intergenic
1091337547 11:134783798-134783820 CTGAGAGAAAGTTATGAAGAAGG + Intergenic
1093518153 12:20015757-20015779 CAGAGAGAATGGTGTGAAGATGG - Intergenic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1096212671 12:49778436-49778458 CTGAGGGATTTTAGGGAAGAAGG - Intergenic
1097319279 12:58207453-58207475 CTTAGGGAATATTTTGAAGAAGG + Intergenic
1098131997 12:67360853-67360875 ATGAGGGAATGTAATGAAATTGG + Intergenic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099671479 12:85699798-85699820 CAAAGGGAATGGAGTTAAGAGGG - Intergenic
1099885705 12:88527432-88527454 CTGAGGAAGGGTACTGAAGAGGG + Intronic
1099963735 12:89422489-89422511 CTTAGAGAATGTACAGAAGATGG - Intronic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1100628435 12:96361198-96361220 CTGAGGGGATGTGATGAAGATGG + Intronic
1101568418 12:105931511-105931533 CTGAGAGAATGTAGGGCATATGG - Intergenic
1101708759 12:107245555-107245577 CTGAGAGAAGGTAGAGGAGAAGG - Intergenic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105522512 13:21143605-21143627 CTGAGGGTATAAAGTCAAGACGG + Intronic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1108522702 13:51259891-51259913 GGGAGGGAAGGTGGTGAAGATGG + Intronic
1110724686 13:78806715-78806737 AGGAGGGAATGAAGTGAAGTTGG + Intergenic
1111396125 13:87672048-87672070 AGGGGGGAATGTGGTGAAGACGG + Intergenic
1112227838 13:97558040-97558062 CTAAGGGACTGTACTGGAGAAGG - Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1115664066 14:35528349-35528371 CTGAGGGAAAGATGTGGAGAAGG - Intergenic
1117925568 14:60775693-60775715 CTGAAGGAATGCAGTTAATATGG + Intronic
1120949497 14:90028025-90028047 CTGGGGGAATGCAGTTCAGAAGG - Intronic
1123580547 15:21711558-21711580 CAGAGGGAAGGAACTGAAGAGGG - Intergenic
1123617195 15:22154181-22154203 CAGAGGGAAGGAACTGAAGAGGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1126634358 15:50766581-50766603 GTGTGGGAAAGTAGTGAAGATGG - Intergenic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1129307040 15:74673018-74673040 CTGAGGAAATGTAGAAAATATGG + Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1130749927 15:86700984-86701006 CTGAGGGAATAAAGTGCTGAGGG + Intronic
1131409415 15:92194306-92194328 CTGATGGAATGAAGTGTAGTGGG + Intergenic
1202989417 15_KI270727v1_random:445803-445825 CAGAGGGAAGGAACTGAAGAGGG - Intergenic
1132761646 16:1511302-1511324 ATGGGGGAATGTGGTGATGAGGG + Intronic
1133846365 16:9457634-9457656 CTGAGAGAAGTCAGTGAAGATGG + Intergenic
1136462231 16:30418541-30418563 CCGAGGGAATGTAGTGATGTGGG - Exonic
1138267906 16:55673254-55673276 CTGATGGAATGCACTGAGGAGGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1147262426 17:39216410-39216432 CTGAGACACAGTAGTGAAGAAGG - Intronic
1147370527 17:39989521-39989543 CTTAGGGAATGCAGTGCAGTGGG - Intronic
1147713795 17:42490080-42490102 TTAAGAGAAGGTAGTGAAGAAGG + Intronic
1149534671 17:57423664-57423686 CTGAGGGAGGGAAGTCAAGAAGG - Intronic
1153892084 18:9526656-9526678 CTTTGGAAATGTAGTGATGAGGG + Intronic
1154390418 18:13931917-13931939 GTGAGGGAAAGTGGGGAAGAGGG - Intergenic
1155897289 18:31346139-31346161 ATGAGGGAATGTAGAGAAGGAGG + Exonic
1156006780 18:32451588-32451610 TTGTGGGAATGTAGTGGAGCAGG - Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1158485804 18:57864787-57864809 CTGAGGGGATACAGTGAATATGG + Intergenic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164754290 19:30678483-30678505 CTGAGAGAAGATGGTGAAGAAGG - Intronic
1166008690 19:39925489-39925511 TGGAGGGAAGGTAGGGAAGAGGG - Intronic
1166189849 19:41169117-41169139 CTGAGAGCATGTACTGAAAATGG - Intergenic
1168419559 19:56192454-56192476 CTGATGGAACGTAGGGAAGGAGG - Intronic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
926693212 2:15751655-15751677 CAGAGGGAATGTAGAGTAAAGGG + Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
930426189 2:51216080-51216102 CTAATGGAACTTAGTGAAGAAGG + Intergenic
931374553 2:61695517-61695539 GTGAAGGAATTCAGTGAAGAGGG - Intergenic
931862021 2:66365191-66365213 TTGAGGGAATGAAGTTCAGAGGG - Intergenic
932983595 2:76699207-76699229 GTGAGAGAAACTAGTGAAGAGGG - Intergenic
935626835 2:105178651-105178673 CTGATGTAATGAAGTTAAGATGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
937091468 2:119209252-119209274 CTGGGGGAGTGAAGTGGAGAAGG - Intergenic
941610301 2:167653603-167653625 CTGAAGGAATGCAGTGCACAGGG - Intergenic
942050698 2:172137819-172137841 CTTAGGGAATGGAGTTTAGAAGG - Intergenic
942916727 2:181318014-181318036 TTGAAGAAATGTAGTGAACAAGG - Intergenic
943991104 2:194693592-194693614 ATGAGGTACTGTAGTGAATAAGG + Intergenic
944388174 2:199187897-199187919 TGAACGGAATGTAGTGAAGATGG - Intergenic
944998754 2:205325039-205325061 CTAAGGAAGTGCAGTGAAGATGG - Intronic
946813228 2:223549442-223549464 CTGGGTGAATGTGGTGCAGATGG - Intergenic
948636059 2:239338354-239338376 CTGATGGAATGAAGGGAAGCGGG - Intronic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
1168879820 20:1196844-1196866 CTGATGCAATGTAGTGACAAGGG - Intergenic
1168884867 20:1242064-1242086 CTGAGGAAAGGTGGGGAAGAGGG - Intronic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1170126866 20:12973269-12973291 TGGAGGGAATGTGGTGAAAAAGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1174712518 20:52722384-52722406 ATCAAGGAATGTAGTGATGATGG + Intergenic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1177176175 21:17702942-17702964 CTGAGGGAATTTACTGTAGATGG + Intergenic
1178487750 21:33029711-33029733 CTGGGGGAGGGTAGTGGAGATGG - Intergenic
1179603194 21:42495020-42495042 CTGGGAGAAAGTAGTAAAGAGGG + Intronic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949100402 3:137313-137335 CTGAGAGAAGGTAGTGAGGCAGG - Intergenic
949257828 3:2070145-2070167 CTGAGGTAATTTAGTCAAGAAGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
953263810 3:41366328-41366350 ATGAGGGAAAGTAGGTAAGATGG + Intronic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
957164998 3:76661449-76661471 CTGAGAGTATGTACTCAAGATGG + Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
958880468 3:99663692-99663714 ATGAAAGAAAGTAGTGAAGATGG + Intronic
959371199 3:105528208-105528230 AGGTGAGAATGTAGTGAAGACGG - Intronic
959654669 3:108789064-108789086 TTGAGAGAATGTAGAGAAAAGGG + Intergenic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
962953616 3:140244047-140244069 CTGAGGTAAAGTAGAGAGGAAGG + Intronic
963263372 3:143214871-143214893 CTGAGGGAAATTCTTGAAGAGGG - Intergenic
965033180 3:163400788-163400810 TTGAGGGAGAGTAGTGAAGGAGG - Intergenic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
967657256 3:192065304-192065326 CTTAGGGAATGTTGTCAGGAGGG - Intergenic
968252094 3:197228009-197228031 CTGAGGCACTGCAGTGAAAAAGG - Intronic
969549790 4:7857396-7857418 CTGAAGGAATATTGTGCAGATGG - Intronic
969723362 4:8905539-8905561 ATGATGGAATGAAATGAAGAGGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
971553540 4:27982481-27982503 CACAGGGCAAGTAGTGAAGAAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
976443884 4:85108389-85108411 CAGAGGTAATGTAGTGAATGTGG - Intergenic
976913366 4:90337369-90337391 CTGAGGCCAAGTCGTGAAGAGGG + Intronic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980091689 4:128449481-128449503 AAGAGGAAATGTAGAGAAGAGGG + Intergenic
981432146 4:144673416-144673438 TTGTGGTAATGTAATGAAGAGGG + Intronic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984661756 4:182382048-182382070 CTGATAGAATGTATTAAAGAGGG + Intronic
984959166 4:185077810-185077832 CTGAGAGAATGAAATGAAGCGGG - Intergenic
996236276 5:121134560-121134582 ATGTGTGAAGGTAGTGAAGAGGG - Intergenic
996411224 5:123161665-123161687 CTGAGTGAGTGAGGTGAAGAGGG + Intronic
997408319 5:133669994-133670016 TTGAGGGAATGTGGTGAGGGAGG - Intergenic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
1000178288 5:158780650-158780672 CTGAAGGAATTTATTGAAAAGGG + Intronic
1000360619 5:160443320-160443342 CAGAGAGAAAGAAGTGAAGAAGG - Intergenic
1000698818 5:164422393-164422415 CAGAGGGCATGTAGTGATGAGGG - Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002329554 5:178432277-178432299 CAGAGGGAATTTAATGCAGACGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004070873 6:12296242-12296264 CTGATGGAAGCCAGTGAAGATGG - Exonic
1004993309 6:21163287-21163309 CTGAGAGAATGAAGTGGAGGAGG - Intronic
1006905333 6:37529490-37529512 ATGAAGGAATGGAGTGATGAAGG - Intergenic
1007286569 6:40752102-40752124 CTGAAGGTCAGTAGTGAAGAGGG - Intergenic
1007567120 6:42860078-42860100 GTGAGGGAATGCAGTGTAGAAGG + Intronic
1008645534 6:53510313-53510335 CTCAGAGAATGTCCTGAAGATGG + Intronic
1008844676 6:55949369-55949391 CTGAGGGGGTGTGGTGAAGCTGG - Intergenic
1009036106 6:58118653-58118675 CTCAGAGAATGTAGAGAAGCAGG + Intergenic
1009211923 6:60872272-60872294 CTCAGAGAATGTAGAGAAGCAGG + Intergenic
1012330572 6:97980014-97980036 ATGAGTGAATGTAGTAAAGGAGG + Intergenic
1012620069 6:101333117-101333139 CTAAAGGAATGCAGAGAAGAAGG - Intergenic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1018492962 6:164315591-164315613 CTGCTGGCATGTAGTGATGAAGG + Intergenic
1019871497 7:3767677-3767699 ATGAGGTAATGTAGTTAGGAGGG + Intronic
1020184222 7:5946652-5946674 CTGAGGGATTGTGATGTAGACGG - Intronic
1020298695 7:6778114-6778136 CTGAGGGATTGTGATGTAGACGG + Intronic
1021224905 7:18015224-18015246 CTGATAGAATATAGAGAAGAAGG + Intergenic
1022052790 7:26695161-26695183 CTGAGGGTATTTAGTGAGAAAGG - Intronic
1022280928 7:28908417-28908439 CTGAGGGAAGGGGGTGAGGAGGG + Intergenic
1022802046 7:33786118-33786140 ATGAGGGACTGTATTGGAGAGGG + Intergenic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1024301100 7:47888529-47888551 CTGAGGCAAGGCAGCGAAGAGGG - Intronic
1026080861 7:67218940-67218962 TTGAACGAAAGTAGTGAAGATGG + Intronic
1026144501 7:67734808-67734830 CTGGGGGAAGGCAGTGTAGAAGG - Intergenic
1026696222 7:72595092-72595114 TTGAAGGAAAGTAGTGAAGATGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031989285 7:128186455-128186477 TTGAGGGAAGGAAGAGAAGAAGG - Intergenic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1034554726 7:151842657-151842679 GTGAGGGTAGGTAGTGATGATGG + Intronic
1035012418 7:155731216-155731238 CTGATGGAAGGTAGGAAAGAAGG + Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035966406 8:4196884-4196906 ATGTGGGAATTTAATGAAGATGG - Intronic
1038615409 8:29089534-29089556 CTCAGGGAATATTGTGGAGAGGG + Intronic
1039742563 8:40395937-40395959 CTGAGGGAGGGTAGAGAAGGGGG + Intergenic
1040864211 8:52032002-52032024 ATGAGGGATTCTAGGGAAGAAGG - Intergenic
1042823056 8:72952754-72952776 CTGAGGGAAGAGGGTGAAGAGGG - Intergenic
1043916011 8:85922805-85922827 CTGAGGGAATCAGGGGAAGAAGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045611317 8:103846345-103846367 GTAAGGGAATGGAGTGAAGCAGG + Intronic
1045815362 8:106271075-106271097 CTGAGGGATTTGGGTGAAGAGGG + Intronic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048775909 8:137945956-137945978 CTGAGTGAATGAAGTAATGATGG - Intergenic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1048884509 8:138898880-138898902 CATAGGGAATTTAGTGTAGAGGG - Intronic
1048986247 8:139736642-139736664 CTGAGGAAATGTGGTGGAAACGG + Intronic
1049226994 8:141458854-141458876 CAGAGGGAAAGTAGTGAAAATGG + Intergenic
1050249616 9:3730975-3730997 ATTAGGAAATGAAGTGAAGAGGG - Intergenic
1050362016 9:4839187-4839209 CTCAGGCAATGAAATGAAGAAGG - Intronic
1051284566 9:15483063-15483085 CTGAAGGAATATAATGGAGAGGG - Intronic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1060210606 9:121707909-121707931 CTGACGAAATGTGGTGAAGTTGG - Intronic
1061204691 9:129156191-129156213 CTGTGGGAATGTCGTGGACAGGG + Intergenic
1186644581 X:11492973-11492995 CTGAGGGACTATGTTGAAGATGG + Intronic
1186798802 X:13072382-13072404 CTGGGGGCCTCTAGTGAAGAAGG + Intergenic
1188068052 X:25685881-25685903 CTGCGGGAAGGCAGTGAAGGTGG + Intergenic
1190420477 X:50225445-50225467 CTGTGGGAAATTACTGAAGAAGG + Intronic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1191174267 X:57482687-57482709 TTGAGGGAATGAAGCCAAGATGG - Intronic
1193722400 X:85002922-85002944 CTGGAGGAATTTAGAGAAGAGGG - Intergenic
1195084363 X:101400355-101400377 CAGGGTGCATGTAGTGAAGATGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1198686404 X:139232222-139232244 CTGATTAAATGTAGTGAGGAAGG + Intergenic
1199665199 X:150090940-150090962 CTGAGAGAATGTGGAGAAGGTGG + Intergenic
1199785692 X:151102913-151102935 CTAAGGAAATGTAAGGAAGATGG + Intergenic