ID: 979847594

View in Genome Browser
Species Human (GRCh38)
Location 4:125535655-125535677
Sequence CACTCACTACCGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847594_979847602 25 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847594_979847605 29 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847594_979847604 26 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847604 4:125535704-125535726 CCTCTGTGCTTCAGTATTGTGGG No data
979847594_979847598 2 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847598 4:125535680-125535702 GCCTGCCAACACCTTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847594 Original CRISPR CACTCACTACCGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr