ID: 979847595

View in Genome Browser
Species Human (GRCh38)
Location 4:125535656-125535678
Sequence ACACTCACTACCGAGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847595_979847604 25 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847604 4:125535704-125535726 CCTCTGTGCTTCAGTATTGTGGG No data
979847595_979847598 1 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847598 4:125535680-125535702 GCCTGCCAACACCTTCATTTTGG No data
979847595_979847602 24 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847595_979847605 28 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847595 Original CRISPR ACACTCACTACCGAGGCTCT AGG (reversed) Intergenic
No off target data available for this crispr