ID: 979847598

View in Genome Browser
Species Human (GRCh38)
Location 4:125535680-125535702
Sequence GCCTGCCAACACCTTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847597_979847598 -6 Left 979847597 4:125535663-125535685 CCTCGGTAGTGAGTGTGGCCTGC No data
Right 979847598 4:125535680-125535702 GCCTGCCAACACCTTCATTTTGG No data
979847595_979847598 1 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847598 4:125535680-125535702 GCCTGCCAACACCTTCATTTTGG No data
979847594_979847598 2 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847598 4:125535680-125535702 GCCTGCCAACACCTTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847598 Original CRISPR GCCTGCCAACACCTTCATTT TGG Intergenic
No off target data available for this crispr