ID: 979847600

View in Genome Browser
Species Human (GRCh38)
Location 4:125535685-125535707
Sequence GAGGACCAAAATGAAGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847600_979847602 -5 Left 979847600 4:125535685-125535707 CCAACACCTTCATTTTGGTCCTC No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847600_979847604 -4 Left 979847600 4:125535685-125535707 CCAACACCTTCATTTTGGTCCTC No data
Right 979847604 4:125535704-125535726 CCTCTGTGCTTCAGTATTGTGGG No data
979847600_979847605 -1 Left 979847600 4:125535685-125535707 CCAACACCTTCATTTTGGTCCTC No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847600 Original CRISPR GAGGACCAAAATGAAGGTGT TGG (reversed) Intergenic
No off target data available for this crispr