ID: 979847601

View in Genome Browser
Species Human (GRCh38)
Location 4:125535691-125535713
Sequence AGCACAGAGGACCAAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847601_979847605 -7 Left 979847601 4:125535691-125535713 CCTTCATTTTGGTCCTCTGTGCT No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847601_979847607 29 Left 979847601 4:125535691-125535713 CCTTCATTTTGGTCCTCTGTGCT No data
Right 979847607 4:125535743-125535765 GTTTTAAAACATAAATTTGGTGG No data
979847601_979847604 -10 Left 979847601 4:125535691-125535713 CCTTCATTTTGGTCCTCTGTGCT No data
Right 979847604 4:125535704-125535726 CCTCTGTGCTTCAGTATTGTGGG No data
979847601_979847606 26 Left 979847601 4:125535691-125535713 CCTTCATTTTGGTCCTCTGTGCT No data
Right 979847606 4:125535740-125535762 GCTGTTTTAAAACATAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847601 Original CRISPR AGCACAGAGGACCAAAATGA AGG (reversed) Intergenic
No off target data available for this crispr