ID: 979847602

View in Genome Browser
Species Human (GRCh38)
Location 4:125535703-125535725
Sequence TCCTCTGTGCTTCAGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847599_979847602 -1 Left 979847599 4:125535681-125535703 CCTGCCAACACCTTCATTTTGGT No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847595_979847602 24 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847594_979847602 25 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847597_979847602 17 Left 979847597 4:125535663-125535685 CCTCGGTAGTGAGTGTGGCCTGC No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data
979847600_979847602 -5 Left 979847600 4:125535685-125535707 CCAACACCTTCATTTTGGTCCTC No data
Right 979847602 4:125535703-125535725 TCCTCTGTGCTTCAGTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847602 Original CRISPR TCCTCTGTGCTTCAGTATTG TGG Intergenic
No off target data available for this crispr