ID: 979847605

View in Genome Browser
Species Human (GRCh38)
Location 4:125535707-125535729
Sequence CTGTGCTTCAGTATTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979847599_979847605 3 Left 979847599 4:125535681-125535703 CCTGCCAACACCTTCATTTTGGT No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847601_979847605 -7 Left 979847601 4:125535691-125535713 CCTTCATTTTGGTCCTCTGTGCT No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847595_979847605 28 Left 979847595 4:125535656-125535678 CCTAGAGCCTCGGTAGTGAGTGT No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847600_979847605 -1 Left 979847600 4:125535685-125535707 CCAACACCTTCATTTTGGTCCTC No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847594_979847605 29 Left 979847594 4:125535655-125535677 CCCTAGAGCCTCGGTAGTGAGTG No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data
979847597_979847605 21 Left 979847597 4:125535663-125535685 CCTCGGTAGTGAGTGTGGCCTGC No data
Right 979847605 4:125535707-125535729 CTGTGCTTCAGTATTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979847605 Original CRISPR CTGTGCTTCAGTATTGTGGG AGG Intergenic
No off target data available for this crispr