ID: 979863459

View in Genome Browser
Species Human (GRCh38)
Location 4:125723605-125723627
Sequence GCGGTGGCTGCACAGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979863453_979863459 15 Left 979863453 4:125723567-125723589 CCAGAGGGTGGCATTGCTGTATG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG 0: 1
1: 0
2: 2
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979863459 Original CRISPR GCGGTGGCTGCACAGTGATG GGG Intergenic
902326350 1:15703250-15703272 GCGGTGGCTGAGCAGGGATGGGG + Intronic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
915285497 1:154849497-154849519 GTGGTGTCTACACAGTAATGGGG - Intronic
917377572 1:174365694-174365716 ACGGTGGCTGCTGAGGGATGTGG + Intronic
921250224 1:213290491-213290513 TCTGTGGCTCCTCAGTGATGTGG + Intergenic
923234090 1:232015576-232015598 GCCCTGGCTGCCCAGTGGTGGGG - Intronic
923503889 1:234589318-234589340 GCAGTGGCAGCACAGTAAAGAGG + Intergenic
924563088 1:245173276-245173298 GTGGTGGTTGCACAATGGTGGGG + Intronic
924622948 1:245678212-245678234 GAGGCGGCTGCAGAGTGAAGAGG - Intronic
1064453318 10:15463867-15463889 GCAGTGTCTGCACAATGCTGGGG - Intergenic
1067564824 10:47329070-47329092 GCGGTGTGTGCACACTGAGGGGG + Intergenic
1068220379 10:54037405-54037427 TCGGTGGCTGCTCACTGATTAGG - Intronic
1071508221 10:86245693-86245715 GTGGTGGCTGCTCACTCATGTGG - Intronic
1072229996 10:93406630-93406652 GTAGGGGCTGCACAGAGATGGGG - Intronic
1075095564 10:119468657-119468679 GAGGGGGCTGCACACAGATGGGG + Intergenic
1077330294 11:1981222-1981244 CCGGTGGGGGCACAGGGATGAGG - Intronic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1080429630 11:32186222-32186244 GCTGTTACTGCACAGTGCTGTGG + Intergenic
1083155536 11:60820744-60820766 GCAGTGGCTGCACAGGTCTGTGG - Intergenic
1090243936 11:125202457-125202479 GAGGTGGCTGCACTGCCATGTGG + Intronic
1090377793 11:126303794-126303816 GAGGTGGCTGCGCAGTGAAGAGG - Exonic
1202813273 11_KI270721v1_random:36401-36423 CCGGTGGGGGCACAGGGATGAGG - Intergenic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1092998504 12:13973593-13973615 GCAGGGGAGGCACAGTGATGAGG - Intronic
1098704124 12:73665445-73665467 GTGGTGGCGACACAGTGCTGGGG - Intergenic
1101781702 12:107843989-107844011 GCTGTGGCGGCACAGGGGTGGGG - Intergenic
1102564134 12:113783527-113783549 GGGGAGGCAGCACAGTCATGAGG + Intergenic
1103723960 12:122988854-122988876 GCAGTCGCTGCAAAGTGGTGGGG - Exonic
1103929339 12:124440949-124440971 CCTGTGGCTGGACAGTGCTGGGG + Intronic
1104043058 12:125143028-125143050 GTGGAGGCAGCACAGGGATGCGG - Exonic
1106272291 13:28166535-28166557 CTGGTGGCTGCACAGTTCTGAGG + Intronic
1107429867 13:40330745-40330767 TGGGTGGTTGCACAGAGATGGGG - Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1119410271 14:74426038-74426060 GCGGCGGCTGCTCAGGGACGCGG - Exonic
1119439260 14:74617252-74617274 GCTGAGGCTGCGCAGTGCTGGGG - Intergenic
1122087500 14:99317876-99317898 CCCATGGCTGCCCAGTGATGTGG - Intergenic
1122717670 14:103705364-103705386 GTAGGGGCTGCACAGTCATGGGG + Intronic
1122881226 14:104691307-104691329 GTGGTGACTGGAAAGTGATGCGG + Intronic
1122984903 14:105207533-105207555 GCGGTGGCTGCTCAGGGCTGGGG + Intergenic
1124346343 15:28923889-28923911 GCTGAGGCAGCACAGGGATGAGG - Intronic
1127788696 15:62378962-62378984 GCCTTGGCTGCACTGTGATGGGG + Intergenic
1128147170 15:65338079-65338101 GCTGTGGCTGCTTAGTGCTGAGG - Intronic
1128577754 15:68788055-68788077 TCGTTGGCAGCACAGTGATCCGG - Intronic
1130224222 15:82045555-82045577 GCTGGGGCTGGACAGTGACGAGG - Exonic
1131755783 15:95559611-95559633 GGGGTGGATGCAGAGGGATGGGG - Intergenic
1132478542 16:154243-154265 GCGGGGGCGGCTCAGTGAGGGGG - Intronic
1132659580 16:1055358-1055380 GTGGGGGCTGCACGGTGGTGTGG + Intergenic
1132736575 16:1388966-1388988 GTGATGGCTGCACAGCGGTGTGG - Intronic
1132800303 16:1748746-1748768 GCTGTGCCTGCACAATGCTGGGG + Intronic
1132957578 16:2603637-2603659 GCGGCGTCTGCCCAGTGGTGAGG - Intergenic
1133092751 16:3417330-3417352 GTGGTGGCTGCAGAGGGTTGGGG + Intronic
1133130782 16:3675018-3675040 GGGGTGGCTGCACAGCTCTGTGG + Intronic
1133130784 16:3675052-3675074 ACCATGGCTGCACACTGATGTGG + Intronic
1133750993 16:8725285-8725307 GTGGTGGCTGCACAGCATTGTGG - Intronic
1134419427 16:14071718-14071740 GCCGGGGCTGCACAGAGAGGTGG + Intronic
1135509033 16:23066009-23066031 GCGGTGGCTACACACTGATGGGG + Exonic
1136362959 16:29793101-29793123 GAGGAGGCTGCAGAGAGATGGGG + Intronic
1138101736 16:54257355-54257377 GTGGAGGCTGCAGAGGGATGTGG - Intronic
1138295001 16:55878568-55878590 GTGGTGGGGGTACAGTGATGGGG - Intronic
1140929002 16:79609813-79609835 TTGGTGGCAGCACAGTGAGGAGG + Intergenic
1141155205 16:81592559-81592581 GCGGAGGGTGCAAAGTAATGGGG - Intronic
1141304644 16:82850751-82850773 TTGGTGGCTGCTGAGTGATGAGG - Intronic
1142093440 16:88227132-88227154 GCAGTGGCTGCAAAGTGTGGAGG - Intergenic
1143433961 17:6908944-6908966 GTGGTGGCTGCTCAGGGAAGGGG + Intronic
1143456143 17:7069328-7069350 GCAGTGGTGGGACAGTGATGTGG - Intergenic
1144187956 17:12814202-12814224 GAGGTGGCTGCACAGTAACAGGG - Intronic
1147873704 17:43605875-43605897 ATGGTGGCTCCAGAGTGATGGGG + Intergenic
1148347646 17:46914118-46914140 GGGGTGGCTGAAGAATGATGTGG + Intergenic
1149521977 17:57324323-57324345 GAGGTGGCTGCACAGACAGGAGG + Intronic
1150228984 17:63539594-63539616 GCAGATGCTTCACAGTGATGGGG - Intronic
1150763201 17:67980719-67980741 GCTGGGCCTGCACAGTGAAGGGG + Intronic
1151534858 17:74733087-74733109 CAGGTGTTTGCACAGTGATGTGG + Intronic
1151719841 17:75848774-75848796 GCTGGGCCTGCACTGTGATGGGG + Intronic
1152379258 17:79934034-79934056 GCGGTGGCTGCTCAGTGCCTAGG - Exonic
1152427627 17:80226841-80226863 GAGATGGCTGCCCAGTGCTGTGG + Intronic
1152481773 17:80558991-80559013 GTGGTGGCTGCACAAGCATGTGG - Intronic
1152586763 17:81192773-81192795 GCAGCGGCTGTACAGTGAGGTGG - Exonic
1152667062 17:81577234-81577256 GCGAGGACTACACAGTGATGGGG - Intronic
1152903629 17:82958703-82958725 GAGGTGGCTGCAGAGGGTTGGGG - Intronic
1152937792 17:83150545-83150567 GCTGTGGCTGCACAGGGACCTGG + Intergenic
1155255515 18:23994641-23994663 ACGTTGGGTGCATAGTGATGAGG - Intronic
1159836663 18:73345220-73345242 GCGGAGGCTGCACATGGGTGGGG - Intergenic
1160112955 18:76050985-76051007 GTGGTGGCTGCCCAGAGAGGAGG - Intergenic
1162064902 19:8119387-8119409 TCTGTGGCTGAAGAGTGATGAGG - Intronic
1163043030 19:14616723-14616745 GCAGTGGTTGAACAGTGAGGAGG + Intergenic
1166976867 19:46609957-46609979 GCGGTGGGTGCATCGTGAGGAGG - Exonic
1167258481 19:48444282-48444304 CGGGGAGCTGCACAGTGATGTGG - Exonic
925138607 2:1535776-1535798 GCGGAGGTTGCACAGAGTTGGGG - Intronic
925139051 2:1537506-1537528 GCGGAGGTTGCACAGAGTTGGGG - Intronic
926212858 2:10884026-10884048 GCAAAGGCTGCAGAGTGATGAGG - Intergenic
926748630 2:16180807-16180829 ACGATGGGTGCAAAGTGATGGGG + Intergenic
928332381 2:30367678-30367700 GAAGTGGCTGCTCAGAGATGTGG + Intergenic
929455321 2:42061098-42061120 GCGGGGGCTGCAGAGTCAAGGGG - Intergenic
932320497 2:70819020-70819042 TCTGTGGCTGCCCAGGGATGAGG + Intronic
934525897 2:95051421-95051443 GGTGGGGGTGCACAGTGATGGGG - Intronic
935012798 2:99151393-99151415 GCGGAGGCTGCACTGAGCTGAGG + Exonic
936344646 2:111665995-111666017 GAGGAGGGTGCACAGTGAAGGGG - Intergenic
937835806 2:126469309-126469331 GAGGCTGCTGCAAAGTGATGAGG - Intergenic
937969867 2:127541224-127541246 GGGCTGTCTCCACAGTGATGGGG + Intronic
938743755 2:134257787-134257809 GGGCTGGCAGAACAGTGATGTGG + Intronic
943676068 2:190717511-190717533 GGGGGGGCTGCAGAGTGAGGAGG + Intergenic
944800969 2:203237955-203237977 GCGGAGGCTGCACACTGTTCAGG - Intergenic
946330367 2:219005632-219005654 GTGGTAGCTGCCCAGTGATGAGG + Intronic
947168444 2:227286636-227286658 GCTCTGGCAGCACAGTGAGGAGG - Intronic
948779249 2:240307799-240307821 CCGCGGGCTCCACAGTGATGGGG - Intergenic
1169607607 20:7340163-7340185 GTGGTGGCTGCACTGGGTTGGGG - Intergenic
1170150442 20:13221534-13221556 GCGGTGGCTCCGCCGTGGTGCGG + Intergenic
1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG + Intronic
1173292261 20:41725217-41725239 TCAGTGGCTGCTCAGAGATGGGG - Intergenic
1173729345 20:45317695-45317717 CAGGTGCCTGGACAGTGATGAGG + Exonic
1176729139 21:10473170-10473192 GCTCTTGCTGCACAGTGATCTGG - Intergenic
1180073382 21:45449737-45449759 GAGGTGGCCGCACAGTGAGAGGG - Intronic
1180964578 22:19780189-19780211 GTGATGGCTGCACAGTCATGTGG - Intronic
1181509858 22:23384326-23384348 GTGGTGGCTGCACAGCGAGGAGG + Intergenic
1183913048 22:41092827-41092849 GCAGTGGCTGGAGAGGGATGCGG - Exonic
1184490125 22:44803615-44803637 GTGGTGTCTGCATAGTGGTGGGG - Intronic
1185116879 22:48942857-48942879 CCGGGTGGTGCACAGTGATGAGG + Intergenic
1185238899 22:49730421-49730443 GCGATGGTTGCAGAGGGATGTGG - Intergenic
1185284294 22:49993460-49993482 GCGGTGGGTGCACTGGGCTGTGG + Intergenic
1185331880 22:50255614-50255636 GCAGCGGCTGCAGAGCGATGAGG - Exonic
1185376077 22:50483180-50483202 GAGGTGTCTGCCCAGAGATGTGG + Exonic
949516875 3:4815302-4815324 GGGGTGCCTGCCCAGTTATGCGG + Intronic
950528190 3:13536824-13536846 GCTGTGGCTGCACAGTCCAGGGG + Intergenic
952063697 3:29541792-29541814 GAGGTGGGGGCAAAGTGATGAGG - Intronic
953025778 3:39144112-39144134 GTGGTGGCTGGACTGGGATGGGG - Intronic
959086477 3:101855741-101855763 GCTATGACTGCACAGTGAAGGGG - Exonic
962343534 3:134604040-134604062 GCTGTGTCTCCTCAGTGATGGGG + Exonic
963575576 3:147058102-147058124 GTGATGGCTGCACCGTGTTGAGG + Intergenic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
965859961 3:173136871-173136893 TTGGTGGCTGCACAGGGAAGGGG - Intronic
967621768 3:191642472-191642494 GAGGTGCCAGCAAAGTGATGAGG - Intergenic
969045567 4:4334134-4334156 TCTGTGGCAGCACAGTGTTGAGG - Intergenic
969633892 4:8353998-8354020 GGGGTGGATACACAATGATGGGG + Intergenic
971480961 4:27114649-27114671 GAGGTATCTTCACAGTGATGGGG + Intergenic
972511298 4:39770665-39770687 GCGGTGGGGCCACAGTGCTGGGG + Intronic
978054709 4:104249227-104249249 TTGGTGGCTGCACATTGGTGGGG + Intergenic
978710185 4:111770680-111770702 GCTGTGGCAGCACAGGGCTGGGG + Intergenic
979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG + Intergenic
980583943 4:134788947-134788969 GCAGTGGCTGCTCAGGGATGGGG + Intergenic
980744727 4:136999629-136999651 TCTGTGGTTGCACAGTTATGTGG + Intergenic
982166460 4:152617901-152617923 CCGCTGGCTGCACAGTGAACAGG - Intergenic
984284186 4:177708416-177708438 GGGGTGGCTGGGCAGTCATGCGG - Intergenic
985520635 5:372587-372609 GCAGTCGCTGCACAGGGCTGGGG + Intronic
985812668 5:2101558-2101580 CTAGTGGCTGCGCAGTGATGCGG - Intergenic
989016813 5:36945580-36945602 GCGGTGGCTGCAGAGAGCTCAGG + Intronic
998899887 5:146842052-146842074 GTTTTGGCTTCACAGTGATGTGG - Intronic
999175911 5:149631585-149631607 GCTGAGTCTGCTCAGTGATGTGG + Intronic
1002135220 5:177103618-177103640 GCTGTTGCTGCACAGAGATCAGG + Intergenic
1004075358 6:12339843-12339865 GAGGAGGCTGCAGAGTGAGGCGG - Intergenic
1005745708 6:28835517-28835539 CCATTGGCTGCACAGTGATATGG - Intergenic
1006007354 6:31013075-31013097 GTGGTGGCTGAGGAGTGATGCGG - Intronic
1006113052 6:31760348-31760370 GAGGTGGAAGCACAGGGATGTGG - Intronic
1007343998 6:41214531-41214553 GCTGTGGCTGGACAGTGAGCAGG - Intergenic
1012780546 6:103551446-103551468 ATGGTGGCTGCACAGGGCTGTGG + Intergenic
1018133721 6:160757581-160757603 ACGGTGGCTTCACAGTGAGGAGG - Intergenic
1018199068 6:161378733-161378755 GCTGGAGCTGCACTGTGATGTGG + Intronic
1019599313 7:1873501-1873523 GCCGGGGCTGGACAGTGCTGAGG + Intronic
1022877820 7:34553019-34553041 GCAGTGGCTGCTCAGGGCTGGGG - Intergenic
1027402355 7:77822178-77822200 GCAGTGGCAGCAGAGTGTTGGGG + Intronic
1029110179 7:98210118-98210140 GCGGTGACTGCACGCTGCTGGGG - Intergenic
1031280743 7:119796918-119796940 GTGGTGGCTGCAAAGTGAAATGG - Intergenic
1032273236 7:130430933-130430955 GTGGTGGCAGCAGAATGATGAGG + Intronic
1033119639 7:138656064-138656086 GCGGTTGCTGAACATTGAGGTGG - Intronic
1034219949 7:149436462-149436484 GAGGTAGCTGGACACTGATGGGG - Intronic
1035321758 7:158034286-158034308 TGGCTGGCTGCACAGTGATGTGG + Intronic
1035901078 8:3459198-3459220 GTGGTGGCTGCACCGTGGTGGGG + Intronic
1036777634 8:11624637-11624659 GCTGTGTCTGCAGTGTGATGGGG + Intergenic
1039638615 8:39194226-39194248 GCAGTGGCTGCTCAGTGAAGGGG + Intronic
1044165740 8:88981799-88981821 GTGATGGATGCACTGTGATGTGG + Intergenic
1048133576 8:131723706-131723728 AGGGTGGCTACAAAGTGATGAGG + Intergenic
1049146590 8:141005238-141005260 GGGGTGGATGCACAGTCATGGGG + Intergenic
1049194592 8:141308375-141308397 GCGGGTGCTGCATAGTCATGAGG - Intergenic
1051832504 9:21296078-21296100 GTGGTGGCAGCACAGTGCAGAGG - Intergenic
1053508736 9:38669071-38669093 GTGGTGGCTGCACAGAGAGTGGG + Intergenic
1055373503 9:75624915-75624937 GAGGTGGCTGCACTGTGATGGGG + Intergenic
1056645192 9:88405609-88405631 GCGGAGGCTGCAGTGAGATGAGG - Intronic
1056771078 9:89478799-89478821 GCGGTGGCTGCCCAAGGAGGGGG - Intronic
1057114301 9:92506026-92506048 GTGGTGGCTGAACAGGGATTTGG + Intronic
1057294923 9:93829375-93829397 GAGGTGGCAGCACAGTGCTGAGG + Intergenic
1057723290 9:97549955-97549977 GTGGTGGTTGCACAATGTTGTGG - Intronic
1059835090 9:118142710-118142732 GCGGTGGCTTAAAAATGATGTGG + Intergenic
1060996103 9:127875606-127875628 GGGCTGCCTGCACAGGGATGGGG - Intronic
1061434840 9:130554690-130554712 ACAGAGGCTGCACAGGGATGAGG - Intergenic
1061827988 9:133273907-133273929 GCGCTGGCAGCACAGGGAGGAGG + Intronic
1062062450 9:134503725-134503747 GCGTTGGCTGCTCAGTGTAGAGG - Intergenic
1062654075 9:137593104-137593126 GCAGTGGCTGGAAAGGGATGGGG - Intergenic
1203585117 Un_KI270746v1:60905-60927 GCTCTTGCTGCACAGTGATCTGG + Intergenic
1186448627 X:9653606-9653628 GCGGTGGCAGCACGATGAAGAGG - Exonic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1193494721 X:82197141-82197163 GCAATGGCAGCACAGTGCTGAGG + Intergenic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic