ID: 979867419

View in Genome Browser
Species Human (GRCh38)
Location 4:125774189-125774211
Sequence AACCTTTAACAGCTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979867415_979867419 11 Left 979867415 4:125774155-125774177 CCTTGGGCCCAATGAGACTAAGG No data
Right 979867419 4:125774189-125774211 AACCTTTAACAGCTTGAAATAGG No data
979867418_979867419 3 Left 979867418 4:125774163-125774185 CCAATGAGACTAAGGATTATGAC No data
Right 979867419 4:125774189-125774211 AACCTTTAACAGCTTGAAATAGG No data
979867417_979867419 4 Left 979867417 4:125774162-125774184 CCCAATGAGACTAAGGATTATGA No data
Right 979867419 4:125774189-125774211 AACCTTTAACAGCTTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979867419 Original CRISPR AACCTTTAACAGCTTGAAAT AGG Intergenic
No off target data available for this crispr