ID: 979869997

View in Genome Browser
Species Human (GRCh38)
Location 4:125807239-125807261
Sequence CAAACTCCAGAAATTTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979869997_979869999 22 Left 979869997 4:125807239-125807261 CCAATATAAATTTCTGGAGTTTG No data
Right 979869999 4:125807284-125807306 AGGCCATTGAAAGAGTAAACAGG No data
979869997_979869998 2 Left 979869997 4:125807239-125807261 CCAATATAAATTTCTGGAGTTTG No data
Right 979869998 4:125807264-125807286 TTATTCTTACTATTCTAATTAGG No data
979869997_979870000 23 Left 979869997 4:125807239-125807261 CCAATATAAATTTCTGGAGTTTG No data
Right 979870000 4:125807285-125807307 GGCCATTGAAAGAGTAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979869997 Original CRISPR CAAACTCCAGAAATTTATAT TGG (reversed) Intergenic
No off target data available for this crispr