ID: 979872465

View in Genome Browser
Species Human (GRCh38)
Location 4:125841161-125841183
Sequence GGGCCTTATGAACCACTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979872457_979872465 11 Left 979872457 4:125841127-125841149 CCTCCAGGTATAGTGTAGGACCC No data
Right 979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG No data
979872462_979872465 -9 Left 979872462 4:125841147-125841169 CCCCTCTGGAATGAGGGCCTTAT No data
Right 979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG No data
979872458_979872465 8 Left 979872458 4:125841130-125841152 CCAGGTATAGTGTAGGACCCCTC No data
Right 979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG No data
979872463_979872465 -10 Left 979872463 4:125841148-125841170 CCCTCTGGAATGAGGGCCTTATG No data
Right 979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979872465 Original CRISPR GGGCCTTATGAACCACTTTC AGG Intergenic
No off target data available for this crispr