ID: 979872659

View in Genome Browser
Species Human (GRCh38)
Location 4:125844644-125844666
Sequence AGGGGCAAAGAGATGGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979872659_979872663 -4 Left 979872659 4:125844644-125844666 CCTTAATCCATCTCTTTGCCCCT No data
Right 979872663 4:125844663-125844685 CCCTCCTGAATTGATATAAATGG No data
979872659_979872666 12 Left 979872659 4:125844644-125844666 CCTTAATCCATCTCTTTGCCCCT No data
Right 979872666 4:125844679-125844701 TAAATGGCTCATATAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979872659 Original CRISPR AGGGGCAAAGAGATGGATTA AGG (reversed) Intergenic
No off target data available for this crispr