ID: 979872664

View in Genome Browser
Species Human (GRCh38)
Location 4:125844664-125844686
Sequence GCCATTTATATCAATTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979872664_979872666 -8 Left 979872664 4:125844664-125844686 CCTCCTGAATTGATATAAATGGC No data
Right 979872666 4:125844679-125844701 TAAATGGCTCATATAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979872664 Original CRISPR GCCATTTATATCAATTCAGG AGG (reversed) Intergenic
No off target data available for this crispr