ID: 979876635

View in Genome Browser
Species Human (GRCh38)
Location 4:125899565-125899587
Sequence CAGGGTGGCCAGAGAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979876635_979876641 17 Left 979876635 4:125899565-125899587 CCATTATCTCTCTGGCCACCCTG No data
Right 979876641 4:125899605-125899627 CCATGATTTTAAGTTTCCTGAGG 0: 347
1: 6676
2: 8272
3: 6458
4: 4491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979876635 Original CRISPR CAGGGTGGCCAGAGAGATAA TGG (reversed) Intergenic
No off target data available for this crispr