ID: 979879956

View in Genome Browser
Species Human (GRCh38)
Location 4:125942744-125942766
Sequence CACAGTGAAATGGCCAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979879954_979879956 6 Left 979879954 4:125942715-125942737 CCAGCTAGTAAACTAGAGGCACT No data
Right 979879956 4:125942744-125942766 CACAGTGAAATGGCCAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979879956 Original CRISPR CACAGTGAAATGGCCAAGAT TGG Intergenic
No off target data available for this crispr