ID: 979888567

View in Genome Browser
Species Human (GRCh38)
Location 4:126062165-126062187
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979888567_979888569 16 Left 979888567 4:126062165-126062187 CCAATAGCAGGCCAAGAGCTATC No data
Right 979888569 4:126062204-126062226 GCTACCTGCAGAAGATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979888567 Original CRISPR GATAGCTCTTGGCCTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr