ID: 979889825

View in Genome Browser
Species Human (GRCh38)
Location 4:126077325-126077347
Sequence ATCACAGATAACCCTCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889825_979889829 2 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889829 4:126077350-126077372 CAGTGTCTTGGGAGACAGAGTGG No data
979889825_979889836 30 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889836 4:126077378-126077400 GAAAGCTGTGGAAGAGGGGCAGG No data
979889825_979889831 8 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889831 4:126077356-126077378 CTTGGGAGACAGAGTGGATTGGG No data
979889825_979889833 24 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889833 4:126077372-126077394 GATTGGGAAAGCTGTGGAAGAGG No data
979889825_979889828 -9 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889828 4:126077339-126077361 ATCTGTGATGGCAGTGTCTTGGG No data
979889825_979889830 7 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889830 4:126077355-126077377 TCTTGGGAGACAGAGTGGATTGG No data
979889825_979889835 26 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889835 4:126077374-126077396 TTGGGAAAGCTGTGGAAGAGGGG No data
979889825_979889834 25 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889834 4:126077373-126077395 ATTGGGAAAGCTGTGGAAGAGGG No data
979889825_979889827 -10 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889827 4:126077338-126077360 TATCTGTGATGGCAGTGTCTTGG No data
979889825_979889832 18 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889832 4:126077366-126077388 AGAGTGGATTGGGAAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889825 Original CRISPR ATCACAGATAACCCTCCATC AGG (reversed) Intergenic
No off target data available for this crispr