ID: 979889827

View in Genome Browser
Species Human (GRCh38)
Location 4:126077338-126077360
Sequence TATCTGTGATGGCAGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889818_979889827 25 Left 979889818 4:126077290-126077312 CCTACAGAGGCCTGCAGATAATA No data
Right 979889827 4:126077338-126077360 TATCTGTGATGGCAGTGTCTTGG No data
979889817_979889827 26 Left 979889817 4:126077289-126077311 CCCTACAGAGGCCTGCAGATAAT No data
Right 979889827 4:126077338-126077360 TATCTGTGATGGCAGTGTCTTGG No data
979889825_979889827 -10 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889827 4:126077338-126077360 TATCTGTGATGGCAGTGTCTTGG No data
979889821_979889827 15 Left 979889821 4:126077300-126077322 CCTGCAGATAATATGGGAGAAGC No data
Right 979889827 4:126077338-126077360 TATCTGTGATGGCAGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889827 Original CRISPR TATCTGTGATGGCAGTGTCT TGG Intergenic
No off target data available for this crispr