ID: 979889829

View in Genome Browser
Species Human (GRCh38)
Location 4:126077350-126077372
Sequence CAGTGTCTTGGGAGACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889821_979889829 27 Left 979889821 4:126077300-126077322 CCTGCAGATAATATGGGAGAAGC No data
Right 979889829 4:126077350-126077372 CAGTGTCTTGGGAGACAGAGTGG No data
979889825_979889829 2 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889829 4:126077350-126077372 CAGTGTCTTGGGAGACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889829 Original CRISPR CAGTGTCTTGGGAGACAGAG TGG Intergenic
No off target data available for this crispr