ID: 979889830

View in Genome Browser
Species Human (GRCh38)
Location 4:126077355-126077377
Sequence TCTTGGGAGACAGAGTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889825_979889830 7 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889830 4:126077355-126077377 TCTTGGGAGACAGAGTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889830 Original CRISPR TCTTGGGAGACAGAGTGGAT TGG Intergenic
No off target data available for this crispr