ID: 979889832

View in Genome Browser
Species Human (GRCh38)
Location 4:126077366-126077388
Sequence AGAGTGGATTGGGAAAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889825_979889832 18 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889832 4:126077366-126077388 AGAGTGGATTGGGAAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889832 Original CRISPR AGAGTGGATTGGGAAAGCTG TGG Intergenic
No off target data available for this crispr