ID: 979889833

View in Genome Browser
Species Human (GRCh38)
Location 4:126077372-126077394
Sequence GATTGGGAAAGCTGTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889825_979889833 24 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889833 4:126077372-126077394 GATTGGGAAAGCTGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889833 Original CRISPR GATTGGGAAAGCTGTGGAAG AGG Intergenic
No off target data available for this crispr