ID: 979889835

View in Genome Browser
Species Human (GRCh38)
Location 4:126077374-126077396
Sequence TTGGGAAAGCTGTGGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979889825_979889835 26 Left 979889825 4:126077325-126077347 CCTGATGGAGGGTTATCTGTGAT No data
Right 979889835 4:126077374-126077396 TTGGGAAAGCTGTGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979889835 Original CRISPR TTGGGAAAGCTGTGGAAGAG GGG Intergenic
No off target data available for this crispr