ID: 979890122

View in Genome Browser
Species Human (GRCh38)
Location 4:126081896-126081918
Sequence AGGGGCAAACACTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979890117_979890122 17 Left 979890117 4:126081856-126081878 CCGAGTAGGGTGGAATAACTTTT No data
Right 979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979890122 Original CRISPR AGGGGCAAACACTCTGAGGC AGG Intergenic
No off target data available for this crispr