ID: 979893343

View in Genome Browser
Species Human (GRCh38)
Location 4:126128729-126128751
Sequence TCATCCATATGAACTGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979893339_979893343 21 Left 979893339 4:126128685-126128707 CCTGGCTATAAATCAAGCAGCAG No data
Right 979893343 4:126128729-126128751 TCATCCATATGAACTGTTATGGG No data
979893341_979893343 -8 Left 979893341 4:126128714-126128736 CCATCAAATGTCACATCATCCAT No data
Right 979893343 4:126128729-126128751 TCATCCATATGAACTGTTATGGG No data
979893340_979893343 -7 Left 979893340 4:126128713-126128735 CCCATCAAATGTCACATCATCCA No data
Right 979893343 4:126128729-126128751 TCATCCATATGAACTGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979893343 Original CRISPR TCATCCATATGAACTGTTAT GGG Intergenic
No off target data available for this crispr